Labshake search
Citations for Bio-Rad :
251 - 300 of 2014 citations for 5 Methylsulfamoylmethyl 1H indole 3 carboxylic acid methyl ester since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2024Quote: Organoids and Mode-K cells were incubated at 37°C with 5% CO₂ in culture media supplemented with 5 µg/mL PureBlu Hoechst (Bio-Rad) and 5 µg/mL Propidium Iodide ...
-
bioRxiv - Immunology 2024Quote: ... from colonic samples of DR3.IL17A-/- (n = 5) and DR3 mice (n = 5) were reverse transcribed to cDNA using the High-Capacity iScript cDNA synthesis kit (Bio-Rad). qPCR reactions were then carried out in triplicate using 50 ng of cDNA and the Applied Biosystems Power SYBR Green PCR Master Mix (Applied Biosystems) ...
-
bioRxiv - Molecular Biology 2024Quote: ... The RNA primers for PMS2 (5’ATAACGTGAGCTCCCCAGAA; 5’ GAGGACCAGGCAATCTTTGA) and ACTIN (5’GGCTGTATTCCCCTCCATCG; CCAGTTGGTAACAATGCCATGT) were used to amplify target mRNA using iTaq Universal SYBR Green (Biorad, 1725120) and quantified on (Biorad CRX Connect Real-Time PCR Detection System ...
-
bioRxiv - Cell Biology 2024Quote: ... The membranes were then washed five times in 5% TBST (5 minutes each) and incubated with goat anti-mouse IgG secondary antibody (PCS 1706516, Bio-Rad) at a 1:3000 dilution in 5% milk powder in TBST for 1 hour at room temperature ...
-
bioRxiv - Biophysics 2020Quote: ... 3 mL of acrylamide/bis solutions (40%, Bio-Rad Laboratories, CA, USA), 1 mL of 10X tris-borate-EDTA (TBE ...
-
bioRxiv - Neuroscience 2022Quote: ... Equal amounts of proteins were mixed !3-mercaptoethanol-supplemented Laemmli buffer (BioRad), heated to 95°C for 5 min before being separated by SDS-PAGE with Criterion Precast Gels (4 –15% Tris-HCl ...
-
bioRxiv - Molecular Biology 2021Quote: ... 3 trans-blot papers (Bio-Dot SF Filter Paper, Bio-Rad, #1620161) and one cellulose acetate membrane (Cellulose Acetate Membrane Filters ...
-
bioRxiv - Neuroscience 2021Quote: ... All Blue Prestained Protein Standards (1-3 µl; BioRad Laboratories, Hercules, CA) were used to identify band molecular weights ...
-
bioRxiv - Bioengineering 2022Quote: ... along with 3 μL of Precision Plus protein ladder (Bio-Rad #1610374), and gels were run at 125 V for 1.25 hours in Tris-Glycine running buffer (ThermoFisher #LC2675).
-
bioRxiv - Molecular Biology 2023Quote: ... to 3 mL for buffer exchange with an Econo10 DG column (Biorad) equilibrated in buffer A and eluted with 4 mL of the same buffer ...
-
bioRxiv - Biochemistry 2024Quote: ... proteins were separated by Criterion XT Tris Acetate 3-8% (Bio-rad) SDS-PAGE and visualized by silver staining.
-
bioRxiv - Cancer Biology 2024Quote: ... using a Mini PREOTEAN 3 cell (525BR058974; Bio-Rad, Hercules, CA, USA) and PowerPac™ Power Supply (043BR09142 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Membranes were washed 3 times with 0.1% Tween-20 (Bio-Rad,1706531) TBS (TBTS-T ...
-
bioRxiv - Cancer Biology 2023Quote: ... were loaded onto 3-8% Criterion XT tris-acetate gels (Bio-Rad Laboratories ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... and anti-F4/80 FITC (3:100, Bio-Rad Laboratories, Temse, Belgium). The single cells were washed with 1XPBS+1%FBS ...
-
bioRxiv - Cancer Biology 2023Quote: ... and then washed again 3 times before revelation by electrochemoluminescence (Bio-Rad) using the Chemi-doc XRS+ (Bio-Rad).
-
bioRxiv - Microbiology 2023Quote: ... After 3 washes with 0.05% Tween 20 (catalog number 1706531, Bio-Rad) in PBS (TPBS) ...
-
bioRxiv - Biophysics 2024Quote: ... The membrane was blocked by dipping in 3% skimmed milk (Bio-Rad) in PBS containing 0.1% Tween 20 (Amresco ...
-
bioRxiv - Bioengineering 2024Quote: ... Samples were loaded on a 3-8% tris-acetate gel (Biorad 3450131) in Tricine running buffer (Biorad 1610790 ...
-
bioRxiv - Immunology 2024Quote: ... and 3 μL of 10 % (w/v) ammonium persulfate (#1610700, Bio-rad) were added to 500 μL aliquots ...
-
bioRxiv - Neuroscience 2024Quote: ... Each fraction is run through a 3-15% gradient gel (BioRad 45610840) alongside full keratinocyte cell lysate (+ ...
-
bioRxiv - Cancer Biology 2024Quote: ... and filtered 3 times through gel filtration biospin P30 (Bio-Rad France). The purified NAMPT was then transferred to NAMPT elisa wells for quantitation as described in experimental section ...
-
bioRxiv - Biophysics 2024Quote: ... and 3 μL of N,N,N°,N°-tetramethyl ethylenediamine (Bio-Rad) were added to initiate the acrylamide polymerization ...
-
bioRxiv - Plant Biology 2020Quote: ... The mixture was kept for 5 min at 95°C and 5 min on ice before loading on a TGX 4-20% Strainfree (Bio-Rad US) gel immersed in TGS 1X buffer ...
-
bioRxiv - Plant Biology 2020Quote: ... we used 2 µl of a 1/5 dilution of the cDNA obtained as above in a reaction containing 5 µl of SsoFast EvaGreen (Bio-Rad, USA), 0.5 µl of Forward primer (10 µM ...
-
bioRxiv - Pathology 2021Quote: ... CST #2118) in 5% bovine serum albumin (total protein antibodies) or 5% dry milk (phospho-specific antibodies) Tris buffered saline (Bio-Rad #1706435) with 0.1% Tween-20 ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... 0.5 µL of each forward and reverse primer (10 µM) and 5 µL of SsoADV Universal SYBR® Green Supermix (Bio-Rad) were used ...
-
bioRxiv - Neuroscience 2023Quote: ... Membranes were washed again with TBST buffer for 5 times X 5 min and developed using Clarity Western ECL substrate (Bio-Rad, 1004384863). Images were captured on a Luminescent Image Analyzer (GE Healthcare ...
-
bioRxiv - Neuroscience 2024Quote: ... was carried out with 5 ng of cDNA in a volume of 4 μl with 1 μl of 5 μM forward and reverse primers mix and 5 μl of SsoFast EvaGreen Supermix premix (Biorad, CN172-5204). Triplicate reactions were carried out for each mRNA ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Samples were eluted with 6 mM H2SO4 at a flow rate of 0.6 ml/min from an Aminex HPX 87H organic acid analysis column (300 by 7.8 mm) (BioRad). We recorded the areas for all noticeable peaks associated with detected metabolites (glucose ...
-
bioRxiv - Synthetic Biology 2022Quote: ... MD) equipped with a refractive index detector and a HPX-87H organic acid column (Bio-Rad, Hercules, CA) with the following operating conditions ...
-
Hepatitis B Virus genomes associate with cellular sites of DNA damage by inducing replication stressbioRxiv - Microbiology 2024Quote: ... Supernatant was collected and the protein sample concentration was calculated using a bicinchoninic acid (BCA) assay (Bio-Rad).
-
bioRxiv - Developmental Biology 2023Quote: ... Isolated RNA was used to synthesize complementary deoxyribonucleic acid (cDNA) with the iScripttm cDNA Synthesis Kit (Bio-Rad) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2022Quote: ... in 1% (v/v) acetic acid] for 1 min and photographed using Gel Doc XR system (Bio-Rad).
-
bioRxiv - Plant Biology 2024Quote: ... The membranes were stained with a 1:1 mix of glacial acetic acid and Ponceau Red (Bio-Rad) for protein visualisation ...
-
bioRxiv - Microbiology 2021Quote: ... Membranes were blocked with 5% non-fat milk (BioRad) in 1X PBS with 0.1% of Tween 20 (PBS-T ...
-
bioRxiv - Immunology 2021Quote: ... containing 5% Blotting-Grade Blocker (Bio-Rad, # 170-6404) for 1□h ...
-
bioRxiv - Animal Behavior and Cognition 2021Quote: ... 5 µL 2X SSOAdvanced SYBR Green PCR mix (BioRad), and 10 µM each of primer ( total volume ...
-
bioRxiv - Cancer Biology 2021Quote: ... After blocking in 5% non-fat milk (Bio-Rad) for 1 hour at room temperature ...
-
bioRxiv - Neuroscience 2021Quote: ... Membranes were blocked with 5% dry milk (Bio-Rad), incubated with goat polyclonal anti-ACE2 (R&D Systems AF3437 ...
-
bioRxiv - Cancer Biology 2021Quote: ... the membrane was blocked in 5% blocking reagent (Biorad) dissolved in TBS-T rocking for > 1 hour ...
-
bioRxiv - Cancer Biology 2020Quote: ... and supplemented with 5% 2-mercaptoethanol (Bio-Rad Laboratories) for 8 minutes at 100 °C ...
-
bioRxiv - Neuroscience 2020Quote: ... Membranes were blocked using 5% non-fat milk (Biorad) in TBST (0.1% Tween-20 ...
-
bioRxiv - Neuroscience 2020Quote: ... blots were incubated in 5% milk blocking buffer (BioRad) for 1 hour at 4°C before primary antibody overnight at 4°C (See Table 1) ...
-
bioRxiv - Immunology 2020Quote: ... Siglec-7 (5-386, Alexa Fluor 488, Bio-Rad), TIM-3 (7D3 ...
-
bioRxiv - Biophysics 2021Quote: ... 5 μl of anti-Pk antibody (Bio-Rad, MCA1360)-bound Protein A conjugated magnetic beads were added to the reactions and rotated at 25 °C for 10 minutes ...
-
bioRxiv - Developmental Biology 2022Quote: ... Laemmli sample buffer (Bio-Rad #1610747, 5% 2-mercaptoethanol) was added to 20 µg protein and samples were boiled at 95°C for 5 minutes before being loaded onto a 10% SDS-polyacrylamide gel (Bio-Rad #4568034) ...
-
bioRxiv - Neuroscience 2022Quote: ... Membrane was blocked with 5% nonfat milk (Bio-Rad) in TBS-T for 2 hours at room temperature and incubated with primary antibodies overnight at 4°C (Extended Data Table 4).
-
bioRxiv - Molecular Biology 2020Quote: ... 5% methanol) using a trans-blot system (Bio-Rad). Blocking the PVDF membrane was performed by shaking in TBS-T (10 mM Tris-HCl ...
-
bioRxiv - Microbiology 2020Quote: ... followed by blocking with 5 % skim milk (Bio-Rad) in TBST buffer (50 mM Tris/HCl ...