Labshake search
Citations for Bio-Rad :
2901 - 2950 of 4782 citations for Human High Sensitive Interleukin 8 IL8 CLIA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2020Quote: ... was used to remove DNA contaminations and the iScript TM cDNA synthesis kit (Bio-Rad Laboratories) was used for RNA reverse-transcription.
-
bioRxiv - Microbiology 2020Quote: ... Protein bands were visualized using SuperSignal West Pico Chemiluminescent Substrate kits (Bio-Rad, Hercules, CA, USA) and quantified by densitometry using ImageJ software (NCBI ...
-
bioRxiv - Microbiology 2020Quote: ... The membranes were visualized using the chemiluminescence detection kit Clarity ECL Western Blotting Substrates (Bio-Rad) in an Alliance Q9 Advanced machine (Uvitec).
-
bioRxiv - Plant Biology 2020Quote: ... cDNA was synthesized by reverse-transcription using an iScript™ cDNA Synthesis Kit (Bio-Rad; www.biorad.com). Quantitative Real-Time PCR was performed using a SensiFAST™ SYBR® No-ROX Kit (Bioline ...
-
bioRxiv - Microbiology 2020Quote: ... The qRT-PCR assay was done using the iTaq kit according to the manufacturer’s instructions (BioRad). Oligos for the qRT-PCR reactions are shown in table 2 ...
-
bioRxiv - Plant Biology 2021Quote: ... cDNA was synthesized from 750ng RNA using the iScript cDNA Synthesis Kit (Bio-Rad: 170-8890) according to the manufacturer’s protocol ...
-
bioRxiv - Plant Biology 2021Quote: ... 500ng of RNA was used for cDNA synthesis with iScript cDNA synthesis kit (Bio-rad, 1708890). Transcripts of spx1 (F- TGCCGCCTCTACAGTTAAATGGC ...
-
bioRxiv - Plant Biology 2021Quote: ... cDNA was synthesized from 1 μg total RNA using iScript cDNA synthesis kit (1706691, Bio-Rad). Transcript levels were analysed from three biological replicates by real time quantitative PCR (qRT-PCR) ...
-
bioRxiv - Genetics 2021Quote: ... Genotyping was performed by ddPCR using the ddPCR Supermix for Probes (No dUTP) kit (Bio-Rad) and the following primer and probe sets ...
-
bioRxiv - Genomics 2019Quote: ... and 500 ng of total RNA was reverse-transcribed using iScript cDNA synthesis kit (Bio-Rad). qRT-PCR quantification of HIPK-1 ...
-
bioRxiv - Microbiology 2021Quote: ... Mixes were prepared according to the manufacturer’s instructions (iTaq Universal SYBR green One-Step kit, BioRad) with 1µL of RNA and a final concentration of 0.3µM of each primer.
-
bioRxiv - Microbiology 2021Quote: ... and used directly for quantitative PCR (qPCR) analysis with the SYBR green qPCR kit (Bio-Rad).
-
bioRxiv - Microbiology 2021Quote: ... and used directly for quantitative PCR (qPCR) analysis with the SYBR green qPCR kit (Bio-Rad). Signals obtained by qPCR were normalized to those for 18S unless otherwise noted.
-
bioRxiv - Microbiology 2021Quote: ... RNA (1 μg) was reverse transcribed using an iScript gDNA Clear cDNA synthesis kit (Bio-Rad). Quantitative PCR was performed with SYBR green (SsoAdvanced ...
-
bioRxiv - Microbiology 2021Quote: ... cDNA was reverse transcribed from RNA samples using the iScript cDNA Synthesis Kit (Biorad, Hercules, CA) according to the recommended reaction protocol on the ProFlex PCR System (Applied Biosystems ...
-
bioRxiv - Microbiology 2021Quote: ... 2.5 ul of RNA was amplified using the iTaq Universal SYBR Green One Step kit (Biorad) and the following primers (SD29629:AGAAAACGCCGGTAGCAGAA and SD30197:CCTTCCCGAGCCTTCAACAT ...
-
bioRxiv - Molecular Biology 2021Quote: ... cDNA was synthesised from 2 µg purified RNA using iScript™ cDNA Synthesis Kit (Bio-Rad) and quantified by qRT-PCR using iTaq™ Universal SYBR® Green Supermix ...
-
bioRxiv - Cell Biology 2021Quote: ... Protein concentration in lysates in urea buffer was quantified with a Bradford Protein assay kit (Biorad) and lysates in RIPA buffer with BCA protein assay kit (Pierce) ...
-
bioRxiv - Cell Biology 2021Quote: ... Protein concentrations were measured using the DCTM Protein Assay Kit I from Bio-Rad (cat # 5000111) by following the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2020Quote: ... 500 ng RNA was used for cDNA synthesis using the iScript cDNA Synthesis Kit (BIO-RAD) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: ... The supernatant was collected and estimated for protein concentration using DC protein assay kit (Bio-Rad). For immunoblotting ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Protein concentration in the supernatant was measured using DC™ Protein assay kit (BIO-RAD, UK) according to manufacturer’s specifications using bovine serum albumin (BSA ...
-
bioRxiv - Cancer Biology 2021Quote: ... The cDNA was generated from the RNA samples using an iScript kit (BioRad, Hercules, CA, USA) per manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2021Quote: ... scATAC-Seq libraries were prepared using the SureCell ATAC-Seq Library Prep Kit (17004620, Bio-Rad) and SureCell ATAC-Seq Index Kit (12009360 ...
-
bioRxiv - Cell Biology 2022Quote: ... Quantitative PCR was performed using the iScript one step RT-PCR SYBR green kit (Bio-Rad). RT-qPCR was performed in duplicate for each of three independent biological replicates ...
-
bioRxiv - Synthetic Biology 2022Quote: The qRT-PCR reaction was conducted using the iTaq Universeral Probes one-step kit (Bio-Rad) supplemented with SybrGreen I nucleic acid stain (Invitrogen) ...
-
bioRxiv - Molecular Biology 2022Quote: ... Protein concentration was determined using the Bio-Rad DC™ Protein Assay Kit (Bio-Rad Laboratories) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... and cDNA was prepared from samples with RIN > 6.0 using the iScript cDNA Synthesis Kit (BioRad). Gene expression was analyzed with SYBR-based reagents on a StepOne Plus Machine (Applied Biosystems) ...
-
bioRxiv - Pathology 2022Quote: ... Total RNA (1 mg) was reverse-transcribed using iScript select cDNA synthesis kit (Bio-Rad, USA) as per manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2022Quote: ... RNA was reverse-transcribed to obtain cDNA using the iScript cDNA synthesis kit (Bio-Rad, 1708891), and qPCR was performed using PowerUp SYBR Green Master Mix (ThermoFisher ...
-
bioRxiv - Pathology 2022Quote: ... we mixed the obtained cDNA with the SsoAdvancedTM Universal SYBR® Supermix kit (Bio-Rad, USA). After that ...
-
bioRxiv - Molecular Biology 2022Quote: ... cDNA was then prepared from 100 ng RNA using the iScript cDNA synthesis kit (Bio-Rad). qRT-PCR reactions were set up with 4 biological replicates ...
-
bioRxiv - Microbiology 2022Quote: ... and used directly for quantitative PCR (qPCR) analysis with the SYBR green qPCR kit (Bio-Rad). Signals obtained by qPCR were normalized to those for 18S unless otherwise noted ...
-
bioRxiv - Developmental Biology 2022Quote: ... First-strand cDNA was generated from 1 μg total RNA using the iScript cDNA kit (BioRad) with a poly-T primer as described in the kit’s instructions ...
-
bioRxiv - Developmental Biology 2022Quote: ... cDNA was synthesized from 250 ng of RNA using the iScript cDNA synthesis kit (Bio-Rad) (40 min ...
-
bioRxiv - Microbiology 2022Quote: ... cDNA was synthesized from total RNA (1.0 μg) using iScript cDNA Synthesis Kit (BioRad, Hercules, CA) according to the manufacturer’s protocol.
-
bioRxiv - Molecular Biology 2022Quote: ... and the Aurum™ Total RNA Mini Kit (catalogue #732-6820, Bio-Rad, Hercules, CA, U.S.A.). In addition ...
-
bioRxiv - Cancer Biology 2022Quote: ... 500 μg of RNA was used to synthesize cDNA using iScript cDNA Synthesis Kit (Bio-Rad).
-
bioRxiv - Cell Biology 2022Quote: ... RNA was converted into cDNA using the iScript cDNA synthesis kit (Bio-Rad, Hercules, CA, USA), following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... quantitative PCR was conducted to analyze the extracted DNA using QuantiFast SYBR Green PCR kit (Biorad) with universal 16S rRNA primers 8F ...
-
bioRxiv - Microbiology 2020Quote: ... and used directly for quantitative PCR (qPCR) analysis with the SYBR green qPCR kit (Bio-Rad) on a QuantStudio3 real-time PCR machine ...
-
bioRxiv - Plant Biology 2021Quote: ... Protein content was determined using a commercially kit (Protein Assay Dye Reagent; Bio-Rad, CA, USA) and bovine serum albumin as a standard (Bradford ...
-
bioRxiv - Microbiology 2020Quote: ... were used for detection using the enhanced chemiluminescence detection kits Clarity and Clarity Max ECL (Biorad).
-
bioRxiv - Cancer Biology 2020Quote: ... Quantitative RT-PCR was performed using the iTaq Univer SYBR Green 1-Step Kit (Bio-Rad) on a StepOnePlus Real-time PCR system (Applied BioSystem) ...
-
bioRxiv - Neuroscience 2020Quote: ... and protein concentration of the supernatant was quantified using the DC protein quantification kit (Bio-Rad). Samples were stored at -80 °C until array analysis ...
-
bioRxiv - Molecular Biology 2020Quote: ... and reverse-transcribed to complementary DNA (cDNA) using a iScript cDNA synthesis kit (Bio-Rad, CA).19 Polymerase Chain Reaction was performed using qPCR master-mix (Applied Biological Materials Inc. ...
-
bioRxiv - Neuroscience 2020Quote: ... and then developed and visualized by reaction with chemiluminesence reagent (Clarity Western Blotting Substrates Kit, BioRad) on radiography film (Carestream Blue X-ray film) ...
-
Integrated requirement of non-specific and sequence-specific DNA binding in MYC-driven transcriptionbioRxiv - Molecular Biology 2020Quote: ... cell extracts were quantified with the Bradford-based Protein Assay kit (Bio-Rad Protein Assay, #5000006). After addition of 6X Laemmli buffer (375 mM Tris-HCl ...
-
bioRxiv - Neuroscience 2021Quote: ... samples were transferred on to nitrocellulose membranes using the Biorad Trans-blot transfert system kit (Biorad) according to the supplier technical recommendation (7 min ...
-
bioRxiv - Cancer Biology 2020Quote: ... cDNAs were synthesized from 500 ng total RNA with the iScript cDNA Synthesis Kit (Bio-Rad). cDNAs were subjected to real-time PCR with the SYBR Green Fast Kit (Applied Biosystems) ...