Labshake search
Citations for Bio-Rad :
2751 - 2800 of 5185 citations for Mouse CD252 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2024Quote: ... followed by cDNA preparation using the BioRad iScript cDNA Synthesis kit (BioRad; Cat #:1708891). cDNA was subsequently purified with AMPure XP beads (Thermo Fisher Scientific ...
-
bioRxiv - Physiology 2023Quote: ... Protein concentration was measured using the DC Protein Assay Kit II (5000112, Bio-Rad) following manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2023Quote: ... Protein concentration was measured using a RC-DC kit (Biorad Lab., Hercules, CA, USA) according to the manufacturing protocol ...
-
bioRxiv - Neuroscience 2024Quote: ... 200ng of totalRNA sample was reverse transcribed with iScript cDNA synthesis kit (Bio-Rad) and quantitative PCR (q-PCR ...
-
bioRxiv - Neuroscience 2024Quote: ... RNA was reverse-transcribed into cDNA using iScript cDNA Synthesis Kit (Bio-Rad; 1708891). GoTaq quantitative PCR (qPCR ...
-
bioRxiv - Cell Biology 2024Quote: ... RNA (1 μg) was reverse transcribed using iScript™ cDNA Synthesis Kit (Bio-Rad), and PCR was performed using Q5® High-Fidelity 2X Master Mix (NEB) ...
-
bioRxiv - Systems Biology 2024Quote: ... and the protein was quantified using the BCA Protein Assay Kit (Bio-Rad, USA). Protein digestion was performed with trypsin following the filter-aided sample preparation (FASP ...
-
bioRxiv - Neuroscience 2023Quote: ... cDNA was reverse transcribed using iScript cDNA Synthesis Kit (Bio-Rad; Hercules, CA, USA), according to the manufacturer’s protocol using 1 µg total RNA in 20-µL reactions.
-
bioRxiv - Microbiology 2024Quote: ... treated with Turbo DNase and converted to cDNA using iScript cDNA synthesis kit (BioRad). Gene expression was quantified using iTaq Universal SYBR Green (BioRad ...
-
bioRxiv - Cell Biology 2024Quote: ... whose concentrations were measured using the DC Protein Assay Kit (Lowry method, BioRad, 5000116), following the instructions provided by the manufacturer.
-
bioRxiv - Immunology 2024Quote: RNA from 5×10^6 splenocytes was extracted with the RNeasy Mini Kit (BioRad) and converted to cDNA using the Maxima First Strand cDNA Synthesis Kit (ThermoFisher Scientific) ...
-
bioRxiv - Neuroscience 2024Quote: ... Proteins were revealed using an enhanced chemiluminescence kit (1705061 Bio-Rad, Hercules, California, USA) and the imaging system LAS-4000 mini (GE HealthCare Technologies Inc. ...
-
bioRxiv - Cancer Biology 2024Quote: RNA was retrotranscribed into cDNA using the iScript™ cDNA synthesis kit (BioRad, 1708891). PCR was performed using Phusion Universal qPCR Kit (Life Tech ...
-
bioRxiv - Developmental Biology 2024Quote: ... Conversion into cDNA was performed using reverse transcription (iScript cDNA Synthesis Kit; Bio-Rad Laboratories ...
-
bioRxiv - Biochemistry 2024Quote: ... The cDNA was prepared by following manufacture’s instruction (iScript select cDNA synthesis kit, BioRad). The GNL primers (GTTTGGAGA CAATGATGGCGT/TCCCGTTCCAGCGAGAGTAAC ...
-
bioRxiv - Cell Biology 2024Quote: ... Total RNA was reverse transcribed to cDNA using the iScript Advanced cDNA kit (Biorad) according to manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2024Quote: ... cDNA synthesis was performed using the iScript cDNA Synthesis kit (Bio-Rad, #170-8891). qRT-PCR was performed in triplicate on a CFX384 Real Time System C1000 Thermal Cycler (Bio-rad ...
-
bioRxiv - Neuroscience 2024Quote: ... The complementary DNA was synthesized using iScript cDNA synthesis kit (Bio-Rad, #1708891, USA), according to the manufacturers’ protocol ...
-
bioRxiv - Cell Biology 2024Quote: ... cDNA was generated from 1ug RNA using iScript reverse transcription kit (Bio-Rad, #1708891) and diluted 1:3 in water ...
-
Genomic dissection and mutation-specific target discovery for breast cancer PIK3CA hotspot mutationsbioRxiv - Genomics 2024Quote: ... RNA was converted to cDNA using the iScript cDNA Synthesis Kit (Bio-rad, 1708890). qPCR was performed using the AREG and ACTB qPCR primer sets (Table S5 ...
-
Genomic dissection and mutation-specific target discovery for breast cancer PIK3CA hotspot mutationsbioRxiv - Genomics 2024Quote: ... RNA was converted to cDNA using the iScript cDNA Synthesis Kit (Bio-rad, 1708890). qPCR was performed using the AREG and ACTB qPCR primer sets (Table S5 ...
-
bioRxiv - Bioengineering 2024Quote: ... Protein concentrations were determined by Bradford protein assay reagent kit (BIO-RAD, Hercules, CA). Visible GFP bands in the Comassie Blue Stained protein gels were quantified with 1D-Multi lane densitometry (Alpha Innotech Alphaimager 2200 ...
-
bioRxiv - Cell Biology 2024Quote: ... and then transcribed into cDNA using the iScript™ cDNA Synthesis Kit (Bio-Rad), following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2024Quote: ... cDNA synthesis was then performed using reverse transcription kits (Bio-Rad Laboratories, Hercules, CA). qPCR was carried out with TaqMan® probe/primers (Applied Biosystems ...
-
bioRxiv - Cancer Biology 2023Quote: ... and 1 μg was reverse transcribed using the iScript cDNA Synthesis kit (Bio-Rad). Real-time quantitative RT– PCR was performed on a LightCycler 2.0 apparatus (Roche ...
-
bioRxiv - Neuroscience 2023Quote: ... Protein concentrations were determined using the Bradford Protein Assay kit (Bio-Rad, Hercules, CA). Proteins were separated by electrophoresis on 4-20% SDS-PAGE gels (Bio-Rad ...
-
bioRxiv - Cancer Biology 2023Quote: ... iTaq™ Universal SYBR® Green Supermix kit (cat. #1725124, Bio-Rad Laboratories Ltd.) was used according to the manufacturer’s recommendation with cDNA (diluted 1:10∼20 ...
-
bioRxiv - Immunology 2023Quote: ... Extracted RNA was converted to cDNA with an iScript cDNA Synthesis Kit (Bio-Rad), followed by qPCR reactions using SYBR Select Master Mix (Thermo Fisher Scientific) ...
-
bioRxiv - Developmental Biology 2022Quote: ... cDNA was synthesized using an iScript-cDNA Synthesis kit (Bio-Rad, Hercules, CA, USA). iTaq Universal SYBR Green Supermixes (Bio-Rad ...
-
bioRxiv - Neuroscience 2023Quote: ... or ddPCR using One-Step RT ddPCR Advanced Kit for Probes (Bio-Rad 1864022). Copy numbers were calculated with a regression curve from control RNA transcript standards and normalization to per µg RNA in cortex or per ml CSF ...
-
bioRxiv - Neuroscience 2023Quote: ... PCR reactions were assembled using the ddPCR Supermix for Probes (No dUTP) kit (BioRad). Each ddPCR reaction contained 1 µl cDNA and either Dbh and Tbp or Th and Tbp probes (250 nM each ...
-
bioRxiv - Immunology 2022Quote: ... and cDNA was synthesized using the iScript cDNA synthesis kit (Bio-Rad, Hercules CA) following the manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2023Quote: ... RNA quality was determined by a bioanalyzer (Biorad, RNA Stdsense kit, Hercules, CA, USA). The RNA was reverse transcribed to cDNA with a SuperScript IV VILO kit (Invitrogen ...
-
bioRxiv - Neuroscience 2023Quote: ... MRNA was reverse transcribed into cDNA using the iScript cDNA synthesis kit (Bio-Rad). Q-PCR was performed on a CFX-Connect Real Time PCR Detection System using SYBR Green Master Mix reagent (Applied Biosystems) ...
-
bioRxiv - Plant Biology 2023Quote: ... Complementary DNA was synthesized from RNA using an iScript cDNA Synthesis Kit (Bio-Rad). qPCR was run with PowerUP SYBR Green Master Mix (Applied Biosystems) ...
-
bioRxiv - Plant Biology 2023Quote: ... The complementary DNA (cDNA) was prepared using iScript™ cDNA Synthesis Kit (Bio-rad) as per manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2023Quote: ... 500 ng of RNA was converted to cDNA using iScript cDNA synthesis kit (BioRad). For Taqman real-time PCR analysis ...
-
bioRxiv - Neuroscience 2023Quote: ... cDNA synthesis was performed using the iScript Reverse Transcriptase Supermix kit (BioRad, Cat# 1708841) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... qRT-PCR was carried out using iScript RT Supermix (BioRad cDNA kit, cart#1708841) and iTaq Universal SYBY green Supermix kit (BioRad cat# 1725121 ...
-
bioRxiv - Plant Biology 2022Quote: ... Total RNA was reverse-transcribed by using iScript TM cDNA synthesis Kit (Bio-Rad) in a volume of 20 μL ...
-
bioRxiv - Neuroscience 2023Quote: ... and 1000ng RNA was used for cDNA synthesis with the Iscript kit (Bio-Rad) as described previously (19).
-
bioRxiv - Physiology 2023Quote: ... Protein concentrations were determined using the DC Protein Assay Kit II (#5000112, Bio-Rad). Proteins (20μg ...
-
bioRxiv - Biochemistry 2022Quote: ... The total protein level was estimated by using the Bradford assay kit (Bio-Rad). 30 µg of total cellular proteins from the individual samples were subjected to SDS-PAGE ...
-
bioRxiv - Immunology 2023Quote: ... and cDNA was synthesized per kit instructions (iScript cDNA Synthesis, Bio-Rad, Hercules, CA). All primers were from Bio-Rad ...
-
bioRxiv - Biochemistry 2023Quote: ... the bound proteins were detected with the ClarityTM Western ECL kit (Bio-Rad Laboratories).
-
bioRxiv - Microbiology 2023Quote: ... Protein concentrations were determined using DC Protein Assay Kit (Bio-Rad; Hercules, CA, USA). Proteins were separated by SDS-PAGE and were blotted onto an Amersham™ Protran® nitrocellulose membrane (Merck KGaA ...
-
bioRxiv - Microbiology 2023Quote: ... following either random priming or gene specific primers by iScript cDNA synthesis kit (BioRad). 20 μL of cDNA reaction is diluted 5 times before the quantitative PCR reaction ...
-
bioRxiv - Immunology 2022Quote: ... RNA was extracted and transcribed to cDNA with a reverse transcription kit (Bio-Rad). Quantitative real-time PCR reactions were performed using SYBR Green Supermix (Bio-Rad) ...
-
bioRxiv - Immunology 2023Quote: ... Generation of cDNA was performed using the iScript cDNA synthesis kit (BioRad cat# 1708890), reverse transcribing 1 μg of RNA per reaction ...
-
bioRxiv - Cell Biology 2023Quote: ... Extracted RNA was used for cDNA synthesis using iScript cDNA Synthesis kit (BIO-RAD) in accordance with manufacturer’s instruction ...