Labshake search
Citations for Bio-Rad :
2751 - 2800 of 10000+ citations for Formaldehyde Detection Kit 1 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... Absorbance was measured at 570nm on a plate reader (BioRad, Watford, UK).
-
bioRxiv - Cancer Biology 2023Quote: ... the plate was loaded in the QX200 Droplet Digital PCR (Bio-Rad) automated system to create the droplets ...
-
bioRxiv - Cancer Biology 2023Quote: ... the plates were loaded into a QX100™ Droplet Reader (Bio-Rad) and each droplet measured on both FAM and HEX channels ...
-
bioRxiv - Biochemistry 2023Quote: ... was prepared and casted into 1.00 mm mini-protean glass plates (Biorad), filling them up to 80% ...
-
bioRxiv - Immunology 2024Quote: ... Plates were then run on CFX384 Touch Real-Time PCR system (BioRad).
-
bioRxiv - Neuroscience 2024Quote: ... Separating gels were cast on BioRad mini-PROTEAN short plates (BioRad, USA). Stacking gels were formulated with 10% acrylamide ...
-
bioRxiv - Neuroscience 2024Quote: ... and plates were read on the CFX384 Real-Time System (Bio-Rad). Data were analyzed via the ΔΔCt method and normalized to either U6 (for miRNAs ...
-
bioRxiv - Cell Biology 2024Quote: ... Plates were imaged on a ChemiDoc MP Imaging System (Bio-Rad Laboratories). Band densitometry analysis was performed using Image Lab 5.0 (Bio-Rad Laboratories) ...
-
bioRxiv - Microbiology 2024Quote: ... and the plate was then blocked with 5% nonfat dry milk (BioRad) in PBS for 3 hours at 37 °C ...
-
bioRxiv - Plant Biology 2020Quote: ... Quantitative real-time RT-PCR using FAST SYBR Green I technology was performed on an CFX96 Touch Real-Time Detection System (Biorad, Feldkirchen, Germany) using standard cycling conditions (15 min 95°C ...
-
bioRxiv - Molecular Biology 2020Quote: ... ATGATAGTAGAGTTGAGTAGCG) and nuclear (GTACCCACCTGTCGTCC, GTCCACGAGACCAATGACTG) genes 105 were used for qPCR on CFX Connect™ Real-Time PCR Detection System (Bio-Rad). Mitochondrial to nuclear DNA ratios were quantified using the ΔΔCt method.
-
bioRxiv - Cell Biology 2020Quote: ... qPCR was run using the SYBR® Green Master Mix on a CFX Connect™ Real-Time PCR Detection System (Bio-Rad). Gene expression was relative to the housekeeping gene Gapdh or Hprt and presented by 2-△Ct 52.
-
bioRxiv - Developmental Biology 2020Quote: ... Membranes were then washed 3 times for 5 min in TBST before detection using Clarity Western ECL Substrate (Bio-rad, 170-5061) and imaging on a ChemiDoc MP (Bio-rad ...
-
bioRxiv - Biophysics 2022Quote: ... pH 7.5 was heated from 15 ºC to 90 ºC with 0.5 ºC increment every 30 seconds on an iCycle iQ5 Real Time Detection System (Bio-Rad, Hercules, CA). The normalized fluorescence data was plotted against temperature (53).
-
bioRxiv - Molecular Biology 2020Quote: ... QPCR was performed using Precision Melt Supermix containing EvaGreen dye (cat# 172-5110) using CFX96 Touch™ Real-Time PCR Detection System (BioRad, USA). Sequences of PCR primers are listed in Table.
-
bioRxiv - Physiology 2020Quote: ... All RTqPCR reactions were performed in triplicate using TaqMan probes™ in combination with CFX96 Touch™ Real-Time PCR Detection System (BioRad), paired with CFX Maestro™ Analysis Software.
-
bioRxiv - Neuroscience 2019Quote: ... The blots were then visualized using the SuperSignal™ West Pico (Thermo Fischer) enhanced chemiluminescence detection system and recorded using a Gel Documentation 2000 system (Bio-Rad).
-
bioRxiv - Plant Biology 2019Quote: ... see Table S1 for primer sequences) and was performed using a CFX Connect Real-Time PCR Detection System (Bio-Rad, Watford, UK) with 40 cycles of 95°C-10s ...
-
Glutathione S-transferase: A Candidate Gene for Berry Color in Muscadine Grapes (Vitis rotundifolia)bioRxiv - Genetics 2020Quote: ... Gene transcript levels were measured by qPCR using a CFX96 Touch Real-Time PCR Detection System (Bio-Rad Laboratories Inc., Hercules, CA). All qPCR reactions were carried out in triplicate and expression for the three genes was normalized against VvUbiquitin (Bogs 2005).
-
bioRxiv - Cell Biology 2019Quote: ... Quantitative real-time PCR was performed by using iQ SYBR Green Supermix on the CFX96 Touch Real-Time Detection System (Bio-Rad Laboratories) with the following conditions ...
-
bioRxiv - Microbiology 2019Quote: ... Real-time qPCR amplification and analysis were performed on a CFX96 Touch Real-Time PCR Detection System (Bio-Rad Inc., Hercules, CA) and carried out as previously described (2) ...
-
bioRxiv - Cancer Biology 2020Quote: ... Quantitative PCR was then performed using the Bio-Rad iTaq™ universal SYBR® Green supermix and analysed using a CFX96TM real-time PCR detection system under the CFX Manager software (Bio-Rad). Gene expression was normalized to hypoxanthine-guanine phosphoribosyltransferase (HPRT) ...
-
bioRxiv - Biochemistry 2020Quote: ... Real time polymerase chain reaction (RT-PCR) was performed with the CFX96 or CFX384 Touch(tm) Real-Time detection system (Bio-Rad Laboratories), using a SensiMix(tm ...
-
bioRxiv - Microbiology 2020Quote: ... 2 pM probe and 0.5 µl AmpliTaq Gold DNA polymerase in a Bio-Rad CFX 96 Real-Time Detection System (Bio-Rad, Hercules, CA). The following cycling conditions were used ...
-
bioRxiv - Plant Biology 2020Quote: ... qPCR was performed with the PerfeCTa SYBR Green SuperMix (Quantabio, USA) in a CFX Connect Real-Time PCR Detection System (Bio-Rad, USA).
-
bioRxiv - Microbiology 2020Quote: ... Real-time quantitative PCR was carried out on three independent biological replicates in a CFX96 Touch™ Real-Time PCR Detection System (Bio-Rad) in 20 μL mix containing 10 μL EvaGreen Universal qPCR Supermix (Bio-Rad) ...
-
bioRxiv - Plant Biology 2021Quote: ... The PowerUp™ SYBR® Green fluorescence dye was used for quantitative gene expression analysis on CFX connect Real-time PCR detection system (Bio-Rad). The details of genes used for expression analysis and the primers are presented in Supplementary Table S3 and S4 ...
-
bioRxiv - Molecular Biology 2021Quote: Plasma viremia was assayed using one-step reverse transcriptase real-time PCR [TaqMan assay] with an automated CFX96 Touch™ Real-Time PCR Detection System (Bio-Rad). qPCR primer sets were taken from previously published studies(16) ...
-
bioRxiv - Cell Biology 2021Quote: ... was done using TransStart Tip Green qPCR SuperMix (TransGen Biotech) and detection was achieved using the CFX Connect™ Real-Time System (BIO-RAD). Primer sequence are listed in Supplementary Table 1 ...
-
bioRxiv - Cell Biology 2021Quote: ... Forward and reverse primers were added at a concentration of 0.2 pmol/ml in a final volume of 20 μl and qRT-PCR was performed on a CFX96 Touch™ Real-Time PCR Detection System (Bio-Rad). The primer list can be found in Table 2.
-
bioRxiv - Neuroscience 2022Quote: ... Real-Time quantitative Polymerase Chain Reaction (RT-qPCR) was performed using a CFX96 Touch Real-Time PCR Detection System (Bio-Rad Laboratories) using 3 ng of cDNA per reaction and Sensifast SYBR No-ROX mix (Bioline Corporation ...
-
bioRxiv - Plant Biology 2022Quote: ... Quantification of cDNA was done by real-time PCR using a CFX96 Real-Time PCR Detection System (Bio-Rad, Hercules, CA, USA) with KAPA SYBR FAST qPCR Master Mix (2x ...
-
bioRxiv - Microbiology 2022Quote: ... All the cDNA products were utilized for the quantitative real-time PCR reaction using the GoTaq qPCR Master Mix on a CFX96 real-time PCR Detection System (Bio-Rad, CA). Primer pairs were designed using Universal Probe library website and shown in Table S4 ...
-
bioRxiv - Microbiology 2020Quote: ... RT-qPCR was performed on the cDNA in the CFX Connect Real-Time PCR Detection System (Bio-Rad, Hercules, CA, United States) using Bullseye EvaGreen Master Mix (MIDSCI ...
-
bioRxiv - Molecular Biology 2020Quote: ... qPCR was performed using the Thermo-Scientific SyBr Green Maxima Mix and the MyiQ2 Two-Color Real-Time PCR Detection System (Bio-Rad Laboratories). Primers that specifically amplify mtDNA are listed in Supplementary table 5 ...
-
bioRxiv - Neuroscience 2021Quote: ... SYBR ROX green qPCR reactions were performed in triplicate and data were collected using a BioRad CFX Connect Real-Time PCR Detection System (BioRad, Hercules, CA). Reactions were denatured at 95°C for 10 min then subjected to 95° C for 15 sec and 60° C for 1 min for 40 cycles ...
-
bioRxiv - Neuroscience 2020Quote: ... we performed qPCR using the CFX Connect Real-Time PCR Detection System with iTaq Universal SYBR Green Supermix (Bio-Rad, Hercules, CA). The qPCR primers are described in Table 1.
-
bioRxiv - Bioengineering 2020Quote: ... and chemiluminescent signals from ECL Prime detection reagents (Cytiva, Little Chalfont, Buckinghamshire, UK) were captured on a ChemiDoc™ Touch imaging system (Bio-Rad).
-
bioRxiv - Cell Biology 2022Quote: ... The membrane was soaked with Chemi-Lumi One L or Chemi-Lumi One Super (Nacalai Tesque) for the signal detection using ChemiDoc XRS+ (Bio-Rad Laboratories).
-
bioRxiv - Genetics 2019Quote: ... Quantitative PCR data was produced on a Bio-Rad CFX96 Real-Time PCR Detection System with iTaq Universal SYBR Green Supermix (Bio-Rad, #1725121) reagent using a forward primer unique to cloned ORFeome genes (5’-GGGGACAAGTTTGTACAAAAAAGCAGGCT ...
-
bioRxiv - Genetics 2020Quote: ... Quantitative PCR data was produced on a Bio-Rad CFX96 Real-Time PCR Detection System with iTaq Universal SYBR Green Supermix (Bio-Rad, #1725121). A forward primer anneals to the attb1 site (5’-GGGGACAAGTTTGTACAAAAAAGCAGGCT ...
-
bioRxiv - Plant Biology 2019Quote: ... The dissociation curve was used to detect primer-dimers and amplification of a single product within the CFX detection system software (BioRad, Hercules, CA).
-
bioRxiv - Cancer Biology 2020Quote: ... for 1 hour at RT and after incubation the blots were developed in an ECL detection solution (Clarity Max ECL substrate, Bio-Rad Laboratories) and signal was detected using ChemiDoc (BioRad Laboratories).
-
bioRxiv - Epidemiology 2019Quote: Potential Spiroplasma density differences between individuals and across seasons were tested via quantitative PCR (qPCR) using a CFX96 Real-Time PCR Detection System and iTaq™ Universal SYBR® Green Supermix (Biorad). The relative amount of Spiroplasma was calculated with the 2-(ΔΔCt ...
-
bioRxiv - Microbiology 2020Quote: ... All qPCR amplifications were carried out as technical duplicates on a CFX96 Real-Time PCR Detection System (Bio-Rad, Hercules, CA, USA). Additional thermal cycling conditions and standards are described in the supplemental methods.
-
bioRxiv - Physiology 2019Quote: ... The immunoreactive protein bands were revealed by ECL prime Western blotting detection reagent (Ammersham™) and detected using ChemiDoc™ Imaging System (Biorad). Densitometry quantification was performed using image lab software (v5.2.1 ...
-
bioRxiv - Genomics 2019Quote: The whole genome amplification was monitored in real time by detection of SYTO13 fluorescence every 15 minutes for 16 h using a Chromo4 real-time PCR instrument (Bio-Rad, USA) or a FLUOstar®Omega plate reader (BMG Labtech ...
-
bioRxiv - Cancer Biology 2019Quote: ... The RT-PCR assay was performed using SYBR Green PCR Master Mix (QPK-212, Toyobo Co.) on the CFX96 real-time PCR detection system (Bio-Rad, USA). The gene-specific primer sequences are listed in Table 1 ...
-
bioRxiv - Animal Behavior and Cognition 2019Quote: ... Quantitative real-time PCR (qRT-PCR) was performed using a Bio-Rad CFX96 Real-Time PCR Detection system (Bio-Rad, CA, USA) and Premix Ex Taq (SYBR Green ...
-
bioRxiv - Cell Biology 2019Quote: ... which was performed using a 2 μl cDNA /20 μl reaction volume on a CFX Connect™ real-time PCR detection system (Bio-Rad) using SYBR Green according to the manufacturer’s protocol ...