Labshake search
Citations for Bio-Rad :
2701 - 2750 of 7138 citations for 7 Chloro 4 hydroxy 1 8 naphthyridine 3 carboxylic acid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: Proteins were visualized using SDS-PAGE with 4-20% Mini-PROTEAN TGX Precast Protein Gels (Bio-Rad) in NuPAGE MOPS SDS Running Buffer (Invitrogen ...
-
bioRxiv - Molecular Biology 2023Quote: ... Cell debris was pelleted by microcentrifugation at 4°C and protein levels quantified using Bradford Assays (BioRad) as previously described (38) ...
-
bioRxiv - Cell Biology 2023Quote: ... Proteins were separated by SDS-PAGE on 4-15% gradient gels (Mini-PROTEAN Precast gels, Bio-Rad) in running buffer (200 mM glycine ...
-
bioRxiv - Cell Biology 2023Quote: ... Individual oxidized proteins were resolved by SDS-PAGE on 4-20% polyacrylamide gel gradient gel (BioRad, 5671093). Resolved proteins were transferred to PVDF membrane at 75 V for 2h ...
-
bioRxiv - Molecular Biology 2023Quote: ... Thirty micrograms of protein lysate were resolved on 4-12% TGX Acrylamide Stain-Free gels (Bio-Rad). Stain-Free gels were imaged prior to transfer to PVDF membrane (Millipore or Bio-Rad ...
-
bioRxiv - Biochemistry 2023Quote: ... the flow chamber was incubated at 4°C overnight with 25 ng/µL Digoxigenin Antibody (Bio-Rad) that adsorbed onto the polystyrene-covered lower surface ...
-
bioRxiv - Cell Biology 2023Quote: ... 30 µg of lysate was migrated in 4-15 percent gradient SDS–PAGE gels (BioRad Labora-tories), transferred onto PVDF membranes (Millipore ...
-
bioRxiv - Neuroscience 2024Quote: ... The efficiency of cross-linking was checked by running samples on polyacrylamide 4%–15% gradient gels (Biorad) followed by Comassie Blue staining ...
-
bioRxiv - Cell Biology 2024Quote: ... and mixed with a one-third volume of 4×Laemmli protein sample buffer (cat. # 1610747, Bio-Rad). Following centrifugation at 20,000×g at 4°C for 10 min ...
-
bioRxiv - Cell Biology 2024Quote: ... 10–20 μg of total protein was separated on 4–12% Bis-Tris gradient gels (Bio-Rad) by SDS-PAGE and then transferred to nitrocellulose membranes ...
-
bioRxiv - Molecular Biology 2024Quote: ... Thirty micrograms of protein lysate were resolved on 4-12% TGX Acrylamide Stain-Free gels (Bio-Rad). The Stain-Free gels were imaged prior to transfer to PVDF (Bio-Rad ...
-
bioRxiv - Plant Biology 2024Quote: ... and 15ug of each sample was loaded into a 4-20% SDS-PAGE precast protein gel (BioRad). Proteins were fractionated by electrophoresis and then transferred to PVDF membranes (BioRad) ...
-
bioRxiv - Biophysics 2024Quote: ... 50 μg of protein was loaded in each well of a 4-20% precast polyacrylamide gel (BioRad). Gels were transferred (1.5 A for 15 minutes ...
-
bioRxiv - Cell Biology 2024Quote: ... Samples were run on a 4-20% MINI-PROTEAN TGX Stain-Free gels (Bio-Rad, Cat #4568093) and transferred to a nitrocellulose membrane for 2 h at 85 V in 4 °C ...
-
bioRxiv - Biophysics 2024Quote: ... Different oligomeric forms of ClyA were separated on a Native-PAGE gel (4 – 20%, Criterion Bio-rad). Lysenin monomers were oligomerized on DPhPC:sphingomyelin liposomes (1:1 ratio ...
-
bioRxiv - Cancer Biology 2024Quote: ... 15 µg of protein sample was run on precast 4-15% gradient Tris-Glycine gels (BioRad 4561084) at 90V for 15 minutes and 120V for 60 minutes ...
-
bioRxiv - Cancer Biology 2024Quote: ... Twenty µg of nuclear proteins were separated on precast 4-15% SDS-polyacrylamide gels (Bio-Rad Laboratories), and then transferred onto polyvinylidene fluoride membranes (Bio-Rad Laboratories) ...
-
bioRxiv - Cell Biology 2024Quote: ... Western blotting analyses were conducted using precast Mini- PROTEAN TGX SDS-PAGE gels (4-20%) (Bio-Rad). Blots were probed with primary antibodies as indicated in the figures and appropriate secondary antibodies.
-
bioRxiv - Biochemistry 2024Quote: ... 30µg of protein was added per well and run on a 4-20% pre-cast gel (Biorad). Membranes were probed with α-ALDH2 (Proteintech 15310-1-AP ...
-
bioRxiv - Cancer Biology 2024Quote: ... Lysate (20 µg) was separated on 4-20% Mini-PROTEAN® TGX Stain-FreeTM protein gels (Biorad) and transferred onto Immun-Blot® Low Fluorescence PVDF membrane (Biorad) ...
-
bioRxiv - Cancer Biology 2024Quote: ... and 10-20 mg protein per lane was electrophoresed on 4-15% precast gradient gels (Bio-Rad). Based on the protein concentration and sample volumes ...
-
bioRxiv - Animal Behavior and Cognition 2024Quote: ... Samples were resolved on 4-20% Mini-PROTEAN® TGX™ Precast Protein Gels (Bio-Rad, 4568096) or 12% polyacrylamide gels and transferred to nitrocellulose membranes ...
-
bioRxiv - Biochemistry 2024Quote: ... boiled and then subjected to separation by SDS-PAGE (4-20% Criterion TGX Precast Midi Gels, BioRad). Separated proteins were visualized by staining with Coomassie Blue R250 (G-Biosciences).
-
bioRxiv - Animal Behavior and Cognition 2024Quote: ... Bait and prey proteins were loaded on separate gels (Bio-Rad 4-20% precast gels cat. #4568094). Proteins were transferred to nitrocellulose membrane and immunoblotted as described above ...
-
bioRxiv - Cell Biology 2024Quote: ... The samples were separated on 4–15% SDS-PAGE gels and transferred to nitrocellulose membranes (Bio-Rad). Membranes were blocked in TBST (TBS + 0.1% Tween-20 ...
-
bioRxiv - Cell Biology 2024Quote: ... Samples were run on 4-15% Mini-PROTEAN TGX precast protein gels (Bio-Rad Laboratories, Hercules, California) in running buffer (250 mM Tris ...
-
bioRxiv - Cell Biology 2024Quote: ... cDNA synthesis was performed by adding 4 μL of iScript™ gDNA Clear cDNA Synthesis (Biorad, 1725035BUN) to 500ng of RNA sample and run in a Thermocycler (Biorad ...
-
bioRxiv - Developmental Biology 2019Quote: ... Gr-1 (1:500, MCA2387, Bio-Rad), Fluorescein labeled DBA-lectin (1:500 ...
-
bioRxiv - Cancer Biology 2021Quote: ... 3 µg of total RNA was used in the reverse transcription reaction using the iScript cDNA synthesis kit (Bio-Rad). Quantitative PCR amplification was performed on the Prism 7900 Sequence Detection System (Applied Biosystems ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5’KI and 3’KI as detailed (Fig 2A and D) with the SsoAdvanced Universal SYBR Green Supermix (Bio-Rad). Briefly ...
-
bioRxiv - Immunology 2020Quote: Densitometric analysis of cleaved caspase 3 immunoblots from three independent experiments were performed using the VersaDoc Imaging System (Bio-Rad) and analyzed with ImageJ 1.52p Fiji package software (https://imagej.net/Fiji) ...
-
bioRxiv - Molecular Biology 2021Quote: ... The protein bound GST beads were washed 3 times in the GST lysis buffer by centrifugation at 1,000 rcf for 3 minutes and resuspended in 4X Laemmli sample buffer (Bio-Rad), heat denatured and centrifuged at 1,000 rcf for 3 minutes ...
-
bioRxiv - Microbiology 2020Quote: ... Cells were centrifuged for 5 min at 7,000 g and washed twice with 200 μL of 1x PBS containing 3% BSA and 0.1% (v/v) Tween-20 (BioRad, Germany). Mounting of cells for STED microscopy was performed as described above.
-
bioRxiv - Cancer Biology 2021Quote: ... Scientific until approximately 3 cm of separation was obtained between the 25 and 37 kDa protein standards (Bio-Rad; 1610375). Using electrophoresis ...
-
bioRxiv - Molecular Biology 2020Quote: ... Each reaction contained 3 technical replicates and were carried out using a CFX384 TouchTM Real-Time PCR Detection System (BioRad Laboratories Ltd. ...
-
bioRxiv - Microbiology 2020Quote: ... Samples were run in 3-12% Bis-Tris gradient gels and transferred to PVDF membranes in a wet blot system (BioRad). Membranes were dried ...
-
bioRxiv - Microbiology 2020Quote: ... were mixed in a 1000:3 ratio and added to the blots prior to visualization via Chemidoc Touch Imaging system (BioRad). For OmpT visualization ...
-
bioRxiv - Cell Biology 2020Quote: ... were added for 4 h and then samples were centrifuged at 10,000g for 3 minutes and washed three times with RIPA buffer and re-suspended in laemmli buffer (Bio-Rad), boiled for 5 minutes ...
-
bioRxiv - Biophysics 2020Quote: ... before being transferred to Whatman 3 MM paper and dried (50°C, 2 hours) using a gel dryer (Model 583, BioRad) attached to a vacuum pump ...
-
bioRxiv - Microbiology 2022Quote: ... Intact cells were divided into 100-μl aliquots and heated individually at different temperatures for 3 minutes in a PCR machine (Biorad), followed by cooling for 2 minutes at room temperature ...
-
Proteolytic cleavage of the extracellular domain affects signaling of parathyroid hormone receptor 1bioRxiv - Pharmacology and Toxicology 2022Quote: ... Lysates were cleared by centrifugation and run on 10% SDS-polyacrylamide gels in a Mini-PROTEAN 3 cell apparatus (Biorad). Proteins were electroblotted onto Immobilon P membranes (Millipore ...
-
bioRxiv - Molecular Biology 2019Quote: ... Reactions were then mixed with 10 pmol of GRIA2 forward primer (5’ GGGATTTTTAATAGTCTCTGGTTTTCCTTGGG 3’) and reverse primer and 1X iTaq Universal SYBR Green Supermix (BioRad). qPCR was monitored with a Roche Lightcycler 96 instrument ...
-
bioRxiv - Biophysics 2019Quote: Proteins for native mass spectrometry were buffer exchanged into 50mM ammonium acetate by 3 rounds of gel filtration using BioGel P6 (Biorad) spin columns according to the manufacturer’s instructions ...
-
bioRxiv - Synthetic Biology 2019Quote: ... A total of 3 μg of protein was loaded to Mini-PROTEAN TGX Stain-Free Gels (10% gel, BIO-RAD). Proteins were transferred to standard PVDF membranes through an OWL semi-dry transfer apparatus ...
-
bioRxiv - Molecular Biology 2019Quote: ... Bound proteins were washed 3 times in 500 mM KCl and eluted on Bio-spin disposable chromatography columns (Bio-Rad) with flag peptide as described in (88) ...
-
bioRxiv - Microbiology 2021Quote: ... Primers (Table 3) were designed using Primer3 Plus (31, 32) to quantify transcripts using Universal SYBR Green Supermix (Bio-Rad) using a Quantstudio 6 Flex (Applied Biosystems ...
-
bioRxiv - Cancer Biology 2021Quote: ... 3 μg of total RNA was used in the reverse transcription reaction using the iScript cDNA synthesis kit (Bio-Rad). Quantitative PCR amplification was performed on the Prism 7900 Sequence Detection System (Applied Biosystems ...
-
bioRxiv - Cell Biology 2021Quote: ... ± phosphatase inhibitor cocktail 3) and incubated for 30 min on ice before addition of MnCl2 and λ-phosphatase (Bio-Rad) to the appropriate samples for 30 min at 30°C ...
-
bioRxiv - Cell Biology 2021Quote: ... The membrane was subsequently washed 3 times in TBS+0.05 % Tween-20 over 45 min and incubated with secondary antibodies for 1 h at RT (20 °C) after washing 3 times in TBS+0.05 %Tween-20 and developed by enhanced chemiluminescence (Bio-Rad) with Image Quant™ LAS 4000.
-
bioRxiv - Cell Biology 2021Quote: ... Membranes were washed with PBS-T 3 times after each step and finally imaged on the ChemiDoc MP Imaging System (Biorad).