Labshake search
Citations for Bio-Rad :
2501 - 2550 of 4440 citations for Human Brain Derived Neurotrophic Factor BDNF ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2021Quote: ... RNA was reverse transcribed to cDNA using the iScriptTM cDNA Synthesis Kit (Bio-Rad Laboratories, Inc.), amplified and detected using Syber Green (Bio-Rad Laboratories ...
-
bioRxiv - Cancer Biology 2019Quote: ... cells were stained with an apoptosis and necrosis staining kit (ABD Serotech, Bio-Rad, Raleigh, NC) according to manufacturer’s instructions and analyzed by flow cytometry on a BD LSRFortessa ...
-
bioRxiv - Molecular Biology 2021Quote: Total RNA was extracted from cells using the Aurum™ Total RNA Mini Kit (Bio-Rad). The spin protocol was employed according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: ... destained for 2 h at room temp (Coomassie Brilliant Blue R-250 staining kit, BIO-RAD), and imaged on a ChemiDoc MP (BIO-RAD).
-
bioRxiv - Developmental Biology 2021Quote: ... and transferred with the Trans-Blot® Turbo™ RTA Transfer Kit (Bio-Rad #170-4275) to a LF (low fluorescence ...
-
Integrated requirement of non-specific and sequence-specific DNA binding in MYC-driven transcriptionbioRxiv - Molecular Biology 2020Quote: ... and protein concentration determined with the Bradford-based Protein Assay kit (Bio-Rad Protein Assay, #5000006). The immunoprecipitation of FLAG-Myc was performed by incubating 2 mg of cell lysate with 40 µl of Anti-FLAG M2 affinity gel (Sigma-Aldrich #A2220 ...
-
bioRxiv - Molecular Biology 2020Quote: ... The total RNA was used for the cDNA synthesis with iScript cDNA Synthesis Kit (Biorad, 1708891) according to manufacturer’s instructions.End point PCR was performed with SapphireAmp (Takara ...
-
bioRxiv - Developmental Biology 2022Quote: ... 500ng of total RNA was used for reverse transcription by IScript cDNA synthesis kit (Bio-Rad). SsoAdvanced Universal SYBR Green Supermix (Bio-Rad ...
-
bioRxiv - Molecular Biology 2021Quote: ... 1ug of RNA was reverse transcribed using the iScript gDNA Clear cDNA Synthesis Kit (BioRad 1725034) and cDNA libraries were diluted 1:5 ...
-
bioRxiv - Cancer Biology 2019Quote: ... Proteins bands were visualised using an Immun-star AP chemiluminescence kit (Bio-Rad, Hercules, CA, USA). The primary antibodies used for the experiment are listed in Table 3 ...
-
bioRxiv - Physiology 2019Quote: cDNA was synthesised from 1μg of total RNA using the iScript cDNA Synthesis Kit (BioRad, Australia) as per manufacturer’s instructions ...
-
bioRxiv - Physiology 2019Quote: ... prior to removal of lipid and other contaminants using the ReadyPrep 2D cleanup Kit (Biorad, 1632130). Samples were then subjected to reduction ...
-
bioRxiv - Developmental Biology 2020Quote: ... from whole zebrafish embryos or sorted cells and reverse transcribed with iScript cDNA Synthesis Kit (BioRad). For qPCR ...
-
bioRxiv - Immunology 2020Quote: ... The supernatants were kept and quantified using the DC method (DC Protein Assay Kit, Bio-Rad).
-
bioRxiv - Molecular Biology 2019Quote: ... iScript cDNA synthesis kit and iTaq Universal SYBR green supermix (both from Bio-Rad Laboratories, USA) were used for isolation of total RNA ...
-
bioRxiv - Plant Biology 2019Quote: ... Complimentary DNA (cDNA) were prepared by following manufacturer’s instruction (iScript select cDNA synthesis kit, Bio-Rad). Validated primers were obtained from AtRTPrimer database (Han and Kim 2006) ...
-
bioRxiv - Biochemistry 2019Quote: ... Reverse transcription assay was performed by using the iScript cDNA Synthesis Kit (BioRad, Hercules, CA, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Systems Biology 2019Quote: ... Proteins were quantified in the supernatants using the RC DC™ protein assay kit (Bio-Rad), according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2019Quote: ... Total RNA was collected in 14μl and was reverse transcribed using the iScript kit (Bio-Rad). Real time was performed in an iQ5 cycler (Bio-Rad ...
-
bioRxiv - Immunology 2019Quote: ... Total RNA was extracted using Aurum™ Total RNA Fatty and Fibrous Tissue Kit (Bio-Rad) according to the manufactures’s instructions ...
-
bioRxiv - Neuroscience 2019Quote: ... and cDNA was made by using the iScript cDNA synthesis kit (Bio-Rad, Hercules, CA, USA). Finally ...
-
bioRxiv - Cell Biology 2019Quote: ... cDNA was synthesized from 1 µg RNA by using the iScript cDNA synthesis kit (Bio-Rad). Quantitative PCR (qPCR ...
-
bioRxiv - Biochemistry 2020Quote: ... and cDNA obtained using the reverse transcription iScript™ supermix kit (Bio-Rad, Hercules, CA, USA). Real-time RT quantitative PCR reactions were performed in a CFX96™ Real-Time System (Bio-Rad ...
-
bioRxiv - Genetics 2020Quote: ... 1μg of total liver mRNA was reverse transcribed using the iScript kit (Bio-Rad, Hercules, CA). Aliquots of cDNA were amplified in triplicate using TaqMan master mix (Applied Biosystems ...
-
bioRxiv - Cell Biology 2020Quote: ... cDNA was then synthesized from 500ng of RNA using the iScript cDNA Synthesis Kit (Bio-Rad), along with “no reverse transcriptase” and “no RNA” negative controls ...
-
bioRxiv - Bioengineering 2020Quote: ... and cDNA was prepared using 500 ng sample RNA templates using iScript cDNA Synthesis Kit (BioRad). RT-qPCR analysis was performed on a CFX96 real-time PCR detection system (BioRad ...
-
bioRxiv - Biochemistry 2021Quote: ... Protein concentrations were determined using a Bradford protein assay kit (Quick Start™, Bio-Rad, USA).
-
bioRxiv - Biochemistry 2021Quote: ... Proteins were quantified in the supernatants using the RC DC™ protein assay kit (Bio-Rad), according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2020Quote: ... The cDNA synthesis kit and iQ SYBR Green Supermix were from Bio-Rad (Hercules, CA, USA).
-
bioRxiv - Neuroscience 2021Quote: ... the protein concentration was determined using a Bio-Rad DC™ protein assay kit (Bio-Rad). Proteins (15 µg ...
-
bioRxiv - Physiology 2020Quote: ... cDNA was synthesized by reverse transcription from mRNA using the iScript cDNA Synthesis Kit (Bio-Rad). Gene expression was performed by quantitative real time RT-PCR using Taqman gene expression assay was performed using StepOnePlus detection system (Applied Biosystems ...
-
bioRxiv - Microbiology 2021Quote: ... Protein bands were visualized using SuperSignal West Pico Chemiluminescent Substrate kits (Bio-Rad, Hercules, CA, USA) and quantified by densitometry using ImageJ software (NCBI ...
-
bioRxiv - Cancer Biology 2020Quote: ... Messenger RNA was converted to the first-strand cDNA using iScript cDNA synthesis kit (Bio-Rad), followed by RT-PCR reaction using SYBR Green PCR Master Kit in QuantStudio 5 Systems (Applied Biosystems) ...
-
bioRxiv - Cancer Biology 2020Quote: ... and reverse transcribed into cDNA with iScript™ cDNA Synthesis Kit (BioRad, Hercules, CA, Cat#: 1708891) as stated in the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2020Quote: ... The protein content of the exosomes was measured using a BCA protein assay kit (Bio-Rad). Exosomes were aliquoted and stored at −80°C for further usage.
-
bioRxiv - Cancer Biology 2020Quote: ... 1 µg of RNA was reverse transcribed to cDNA by iScript cDNA synthesis kit (BioRad #17088) as per the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... Protein concentrations for both soluble and pellet fractions were determined by DC protein assay kit (Biorad).
-
bioRxiv - Biochemistry 2021Quote: ... RT-PCR were performed by using Hieff™ qPCR kits (Yeasen, Shanghai, China) on CFX96 (Biorad) according to the manufacturer’s instruction ...
-
bioRxiv - Plant Biology 2021Quote: ... Protein concentrations were determined using the RC DC Protein Assay kit (Bio-Rad, cat. no. 5000122). Quality of protein samples were verified by loading equal protein amounts into an SDS-PAGE gel before capillary immunoblotting ...
-
bioRxiv - Plant Biology 2020Quote: ... was used to remove DNA contaminations and the iScript TM cDNA synthesis kit (Bio-Rad Laboratories) was used for RNA reverse-transcription.
-
bioRxiv - Microbiology 2020Quote: ... Protein bands were visualized using SuperSignal West Pico Chemiluminescent Substrate kits (Bio-Rad, Hercules, CA, USA) and quantified by densitometry using ImageJ software (NCBI ...
-
bioRxiv - Microbiology 2020Quote: ... The membranes were visualized using the chemiluminescence detection kit Clarity ECL Western Blotting Substrates (Bio-Rad) in an Alliance Q9 Advanced machine (Uvitec).
-
bioRxiv - Plant Biology 2020Quote: ... cDNA was synthesized by reverse-transcription using an iScript™ cDNA Synthesis Kit (Bio-Rad; www.biorad.com). Quantitative Real-Time PCR was performed using a SensiFAST™ SYBR® No-ROX Kit (Bioline ...
-
bioRxiv - Microbiology 2020Quote: ... The qRT-PCR assay was done using the iTaq kit according to the manufacturer’s instructions (BioRad). Oligos for the qRT-PCR reactions are shown in table 2 ...
-
bioRxiv - Plant Biology 2021Quote: ... cDNA was synthesized from 750ng RNA using the iScript cDNA Synthesis Kit (Bio-Rad: 170-8890) according to the manufacturer’s protocol ...
-
bioRxiv - Plant Biology 2021Quote: ... 500ng of RNA was used for cDNA synthesis with iScript cDNA synthesis kit (Bio-rad, 1708890). Transcripts of spx1 (F- TGCCGCCTCTACAGTTAAATGGC ...
-
bioRxiv - Plant Biology 2021Quote: ... cDNA was synthesized from 1 μg total RNA using iScript cDNA synthesis kit (1706691, Bio-Rad). Transcript levels were analysed from three biological replicates by real time quantitative PCR (qRT-PCR) ...
-
bioRxiv - Genetics 2021Quote: ... Genotyping was performed by ddPCR using the ddPCR Supermix for Probes (No dUTP) kit (Bio-Rad) and the following primer and probe sets ...
-
bioRxiv - Genomics 2019Quote: ... and 500 ng of total RNA was reverse-transcribed using iScript cDNA synthesis kit (Bio-Rad). qRT-PCR quantification of HIPK-1 ...
-
bioRxiv - Microbiology 2021Quote: ... Mixes were prepared according to the manufacturer’s instructions (iTaq Universal SYBR green One-Step kit, BioRad) with 1µL of RNA and a final concentration of 0.3µM of each primer.