Labshake search
Citations for Bio-Rad :
201 - 250 of 654 citations for Recombinant Human Complement Factor H His tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2022Quote: ... Goat anti-mouse IgG (H + L)-HRP conjugate (1706516, Bio-Rad, 1:3000) and goat anti-rat IgG (H + L)-HRP conjugate (7077 ...
-
bioRxiv - Physiology 2023Quote: ... Goat Anti-Rabbit and Anti-Mouse IgG (H+L)-HRP Conjugate (Bio-Rad) was used as the secondary antibodies ...
-
bioRxiv - Biochemistry 2023Quote: ... The secondary antibodies were ordered from Biorad (Goat Anti-Rabbit IgG (H+L)-HRP Conjugate #172-1019) ...
-
bioRxiv - Cancer Biology 2023Quote: ... The membrane was blocked for 1 h with a blocking buffer (Bio-Rad) under gentle agitation and incubated overnight with antibodies against Arc/Arg3.1 (TA349500 ...
-
bioRxiv - Cell Biology 2023Quote: ... and goat anti- Rabbit IgG (H+L)-HRP conjugate (Bio-Rad; #170-6515). The antibody binding was visualized using Amersham ECL Prime Western Blotting Detection Reagent (GE healthcare ...
-
bioRxiv - Molecular Biology 2023Quote: ... for 1 h at 4°C in a sealed gravity column (Bio-Rad). The beads on the gravity column were washed with 50 ml of high-salt wash buffer (20 mM HEPES ...
-
bioRxiv - Molecular Biology 2023Quote: ... for 1 h (15 V) using a semi-dry blotting system (Bio-Rad). Membranes were dried and UV-crosslinked with 150 mJ/ cm2 at 254 nm ...
-
bioRxiv - Neuroscience 2024Quote: ... at 250 mA for 2 h using the wet transfer method (Bio-Rad Mini Trans-Blot Electrophoretic Cell 170-3930) ...
-
bioRxiv - Molecular Biology 2024Quote: ... An anti-rabbit IgG (H&L) (GOAT) antibody that was peroxidase conjugated (BioRad) was used as the secondary probe ...
-
bioRxiv - Microbiology 2024Quote: ... for 2 h and imaged by a ChemiDoc MP Imaging System (Bio-Rad).
-
bioRxiv - Biophysics 2024Quote: ... The mixtures were incubated for 1 h at RT and then BioBeads (BioRad) were added to each sample and incubated for 2 more hours under constant agitation to remove the detergents ...
-
bioRxiv - Bioengineering 2021Quote: Ramos B cells were retrovirally transduced with a construct encoding spike protein tagged with the fluorophore mScarlet at the C-terminus and sorted by FACS (Bio-Rad S3e Cell Sorter). For the experiment ...
-
bioRxiv - Biochemistry 2020Quote: ... Membranes were probed for 1 hour at room temperature with 1:500 anti-XLF(New England Peptides, details in Methods under Immunodepletion) or 1:1000 anti-His (Bio-Rad MCA1396A) in PBST with 2.5% BSA ...
-
bioRxiv - Molecular Biology 2020Quote: ... goat anti-human IgG Fc (Biorad; 5211-8004; 1:2000) and rabbit anti-Vinculin (EPR8185 ...
-
bioRxiv - Microbiology 2021Quote: ... the Pro™ Human Cytokine 27-plex Assay (Bio-Rad) was used according to the manufacturer’s protocol and read on a Bio-Plex 3D suspension array system including a Bio-Plex Manager software v 6.0 (Bio-Rad).
-
bioRxiv - Developmental Biology 2022Quote: ... or anti-Human IgG Kappa (STAR 127, Bio-Rad, USA) control antibody
-
bioRxiv - Microbiology 2022Quote: ... and HRP-conjugated goat anti-human IgG (BioRad #172-1050) were used as secondary antibodies for ELISA and western blot assays.
-
bioRxiv - Immunology 2019Quote: ... or RasGRP1 (PrimePCR SYBR Green Assay RasGRP1 human, Bio-Rad, amplicon context sequence GGTTCCTTGGTTCCCGGGCATAGGAAAGCTCATAGATTTCATCCTCAGTGTAGTAAAGAT CCAGGGATAACGTCAGCAAGTGTACCAAGTCCTTGTTAGCCTCCAAGG (exon 10) ...
-
bioRxiv - Cancer Biology 2021Quote: ... Bio-Plex Pro Human Cytokine ICAM-1 (BioRad, USA; 171B6009M) and Bio-Plex Pro Human Cytokine VCAM-1 (BioRad ...
-
bioRxiv - Molecular Biology 2022Quote: ... goat anti-human IgG F(ab’)2 (STAR126, Bio-Rad), anti-M13-pVIII-HRP (Cytiva 27-9421-01 ...
-
bioRxiv - Immunology 2023Quote: ... goat anti-human– horseradish peroxidase (HRP) secondary antibody (Bio-Rad) at a 1:3,000 dilution was applied for 1 h at 4°C ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Mouse monoclonal anti-Human Vinculin (V284) antibody (Bio-Rad, MCA465GA), 1:1,000 ...
-
bioRxiv - Molecular Biology 2019Quote: ... and goat anti-mouse IgG H&L HRP conjugate (Bio-Rad, Hercules, CA, USA) was used as the secondary antibody at a dilution of 1:2000 ...
-
bioRxiv - Biochemistry 2020Quote: ... acetylated O-glycans were passed through H+ acid foam (Biorad; Cat. No. 142-1441) and lyophilized ...
-
bioRxiv - Microbiology 2020Quote: ... Bound antibodies were detected with Goat Anti-mouse-IgG (H+L)-HRP Conjugated (BioRad) and bound conjugate was detected using TMB (Invitrogen/Life technologies ...
-
bioRxiv - Bioengineering 2019Quote: ... Membranes were blocked for 1 h with 5% fat free milk powder (Bio-Rad) in TBS + 0.05% tween-20 (Sigma-Aldrich) ...
-
bioRxiv - Microbiology 2019Quote: ... goat anti-mouse IgG (H+L)-HRP conjugate (1:5,000 dilution, Bio-Rad Laboratories). After three washes with TBS-T ...
-
bioRxiv - Neuroscience 2019Quote: ... Nonspecific binding was blocked for 1 h at room temperature with 5% blotto (Biorad) in Tris-buffered saline with 0.1% Tween (TBST) ...
-
bioRxiv - Molecular Biology 2022Quote: ... and HRP-conjugated goat anti-rabbit IgG (H+L) was purchased from Bio-Rad (catalog number ...
-
bioRxiv - Molecular Biology 2022Quote: ... incubated 1 h at room temperature with 1/3000 anti-Mouse StarBright blue700 (BioRad) or 1/2000True blot HRP anti-rabbit antibodies ...
-
bioRxiv - Molecular Biology 2022Quote: ... The gel was dried for 2 h on a Gel Dryer 583 (Bio-Rad) and visualized after appropriate exposure on a Phosphorimager (FLA-3000 Series ...
-
bioRxiv - Molecular Biology 2023Quote: ... and goat anti-rabbit IgG (H+L)-HRP Conjugate antibody (Bio-Rad #170-6515) was used for 2 hours at a dilution rate of 1:3000 in blocking buffer ...
-
bioRxiv - Molecular Biology 2023Quote: ... secondary goat anti-mouse IgG (H+L)-HRP Conjugate antibody (Bio-Rad #170-6516) and goat anti-rabbit IgG (H+L)-HRP Conjugate antibody (Bio-Rad #170-6515 ...
-
bioRxiv - Cell Biology 2023Quote: ... for 1 h at room temperature using ECL solution Clarity Max (Bio-Rad Laboratories) and fluorescence-imaging device (Vilber ...
-
bioRxiv - Molecular Biology 2023Quote: ... Secondary antibodies used are Goat anti Mouse IgG (H/L): HRP (Bio-Rad, STAR207P) and Goat anti Mouse IgG (H/L) ...
-
bioRxiv - Physiology 2023Quote: ... Secondary antibodies used were goat anti-mouse IgG (H+L)-HRP conjugate (Biorad 1706516), AffiniPure goat anti-rabbit IgG (H+L)-HRP conjugate (Jackson ImmunoResearch 111035144).
-
bioRxiv - Cell Biology 2023Quote: ... for 1 h at 4°C using the Mini Trans-Blot Cell (Bio-Rad). After the transfer ...
-
bioRxiv - Cell Biology 2023Quote: ... and goat anti-mouse IgG (H+L)-HRP conjugate (170-6516, Biorad, 1:10000). Antibody binding was detected by the enhanced chemiluminescence system (Thermo Fischer Scientific) ...
-
bioRxiv - Genetics 2024Quote: ... goat anti-mouse IgG (H+L) HRP conjugate (1:10000, Bio-Rad Cat. # 1706516).
-
bioRxiv - Plant Biology 2024Quote: ... and the secondary antibody goat Anti-Mouse IgG (H + L)-HRP conjugate (Bio-Rad) was used at a dilution of 1:5000 ...
-
bioRxiv - Cell Biology 2020Quote: ... The blot was then incubated with HRP-conjugated anti-His monoclonal antibody (1:5000) and detected with supersignalfemto substrate (Thermoscientific, USA) using ChemiDoc imaging system (Bio-Rad laboratories, USA).
-
bioRxiv - Biochemistry 2022Quote: ... acidified to pH3–4 by adding appropriate amount of TFA and subjected to HPLC purification using a C4 reverse-phase column (Hi-Pore reversed-phase column, 4.6 × 250 mm, Bio-Rad, Hercules, CA, USA). The S-sulfonated FAM237A was eluted from the C4 reverse-phase column by an acidic acetonitrile gradient composed of the acidic solvent A (0.1% aqueous TFA ...
-
bioRxiv - Biochemistry 2023Quote: ... and the S-sulfonated FAM237B was eluted from a C4 reverse-phase column (Hi-Pore reversed-phase column, 4.6 × 250 mm, Bio-Rad, Hercules, CA, USA) by an acidic acetonitrile gradient ...
-
bioRxiv - Microbiology 2024Quote: ... and HopAM1 and C-terminal Flag-tagged IpaH4 were generated by PCR amplification using primers containing Flag sequences and flanking SacII / PacI off pIB/V5-His templates using iProof DNA polymerase (Bio-Rad; Table S4) and cloned into the pDGOpIE2 vector ...
-
bioRxiv - Bioengineering 2019Quote: ... Lysate samples were analysed for recombinant protein expression by SDS PAGE (12% Mini-PROTEAN-TGX stain-free gel; Bio-Rad), using Precision Plus unstained protein ladder (Bio-Rad ...
-
bioRxiv - Plant Biology 2020Quote: ... Recombinant proteins were analysed by Western Blot using custom-made SLR1 specific polyclonal antibody with Mini-Protean II system (Biorad).
-
bioRxiv - Immunology 2021Quote: ... Recombinant Bovine Interleukin-8 PBP039 and Goat anti Bovine Interleukin-8 Ab conjugated to biotin AHP2817B (all from Bio-Rad, protocol according to the manufacturer’s intructions).
-
bioRxiv - Biophysics 2022Quote: ... 2 μl of recombinant proteins and 1 μl of a molecular weight marker (Precision Plus Protein Kaleidoscope Prestained Protein Standards, BioRad) were applied to the PAGE lane (10 wells ...
-
bioRxiv - Biophysics 2023Quote: The monovalent streptavidin sample was kindly provided by the Howarth Lab (University of Oxford),23 and recombinant IgE Kappa (clone AbD18705_IgE, Cat#HCA190) was purchased from Bio-Rad Laboratories.
-
bioRxiv - Immunology 2024Quote: 96-well flat-bottom NUNC Maxisorp plates were coated overnight at 4 °C with 0.5 mg/mL recombinant HBsAg (BIO-RAD). Plates were washed with PBS/T ...