Labshake search
Citations for Bio-Rad :
201 - 250 of 3425 citations for ETS Related Transcription Factor Elf 3 ELF3 Antibody HRP since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2022Quote: ... followed by an HRP-conjugated secondary antibody (Bio-Rad 1706515; 1:3000 dilution) before applying ECL HRP substrate (Bio-Rad 1705060 ...
-
bioRxiv - Cell Biology 2022Quote: ... For western blots secondary antibodies coupled to HRP (Bio-Rad and GE-Healthcare) at 1:10.000 dilution were applied (Sheep anti-Mouse ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... followed by incubation with corresponding HRP-conjugated secondary antibodies (Bio-Rad or Abcam) for 1 h at room temperature ...
-
bioRxiv - Cell Biology 2021Quote: ... the membrane was incubated with HRP-conjugated secondary antibody (Bio-Rad, Hercules, CA) for 2 hat RT ...
-
bioRxiv - Biochemistry 2021Quote: ... HRP-conjugated secondary antibodies were detected using Clarity Western ECL Substrate (Bio-Rad). Membranes were then developed with the Odyssey Fc imaging system.
-
bioRxiv - Neuroscience 2021Quote: ... Bands were visualized with secondary antibodies conjugated to HRP (1:10,000; Bio-Rad) and SuperSignal chemiluminescent substrates signal (Thermo Fisher) ...
-
bioRxiv - Plant Biology 2022Quote: ... The secondary antibody Goat Anti-Rabbit IgG (H + L)-HRP (1706515, Bio-rad) was used in combination with α-PDX3 at a dilution of 1:3000 and α-NR at a dilution of 1:10000 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Protein bands were detected using Clarity Chemiluminescent HRP Antibody Detection Reagent (Bio-Rad) and visualized with a chemiluminescence reader (Fusion SL ...
-
bioRxiv - Cancer Biology 2024Quote: ... Secondary antibodies were a-mouse or α-rabbit-HRP (1:5,000; Bio-Rad). Blots were developed using Clarity Western ECL Blotting Substrate (BioRad ...
-
bioRxiv - Cell Biology 2023Quote: ... and a goat anti-rabbit secondary antibody coupled to horseradish peroxidase (HRP) (BioRad). For V5-tagged proteins ...
-
bioRxiv - Plant Biology 2023Quote: ... with goat anti-rabbit HRP secondary antibody (1:3000, Bio-Rad #170-5046). Membranes were developed using the SuperSignal West Pico Chemiluminescent Substrate kit (Fisher #PI34578 ...
-
bioRxiv - Microbiology 2023Quote: ... and antibody detected with goat-anti-rabbit HRP (Bio-Rad, 1706515, 1:5000).
-
bioRxiv - Immunology 2024Quote: ... After washing and incubation with streptavidin-HRP conjugated antibody (1:3000; 1610381; Biorad) for 1 hours at room temperature ...
-
bioRxiv - Physiology 2024Quote: ... they were incubated with secondary antibodies (dilution 1:500) coupled with HRP (BioRad, anti-mouse-HRP #1706516 and anti-rabbit-HRP #1706515) ...
-
bioRxiv - Neuroscience 2024Quote: ... HRP-conjugated secondary antibodies (anti-mouse and anti-rabbit (both 1:3000, BioRad) were used and revealed with chemiluminescence (Amersham ECL Western Blotting Detection Reagents).
-
bioRxiv - Microbiology 2024Quote: ... primary antibodies and goat anti-rabbit HRP conjugate (1:10,000 BioRad Cat#1706515) secondary antibody ...
-
bioRxiv - Cell Biology 2024Quote: ... followed by the appropriate horseradish peroxidase (HRP)-conjugated secondary antibody (Bio-Rad, USA), and developed using Clarity™ Western ECL substrate (BioRad ...
-
bioRxiv - Cell Biology 2020Quote: ... prior to reverse transcription with iScript reverse transcription supermix (BioRad). RT-PCR primers were Pax7 forward 5’-AGGCCTTCGAGAGGACCCAC-3’ reverse 5’-CTGAACCAGACCTGGACGCG-3’ ...
-
bioRxiv - Microbiology 2024Quote: ... Reverse transcription utilized iScript Reverse Transcription Supermix (Bio-Rad, 1708840) with the thermocyler (Applied Biosystems ...
-
bioRxiv - Microbiology 2024Quote: ... membranes were incubated in an appropriate secondary antibody: anti-Rabbit IgG-HRP Conjugate #1706515 and anti-Mouse IgG (H + L)-HRP Conjugate #1706516 (Bio-Rad, Hercules, CA). Image Quant TL Toolbox v8.1 software (Amersham Bioscience ...
-
bioRxiv - Genetics 2021Quote: ... The secondary antibody used with all three primary antibodies was HRP-conjugated goat anti-rabbit (Bio-Rad cat#1662408EDU). Blots were imaged on a SynGene gel imaging system after a 1min exposure to SuperSignal Femto West Maximum Sensitivity Substrate (ThermoFisher) ...
-
bioRxiv - Biochemistry 2020Quote: ... The primary antibodies were detected with anti-mouse HRP-conjugated secondary antibodies (1:5000; Bio-Rad, Hercules, CA, USA), and the signal was developed using Supersignal West Pico Chemiluminescent Substrate (Thermo Scientific) ...
-
bioRxiv - Immunology 2022Quote: ... Membranes were washed and incubated with horseradish peroxidase (HRP)-conjugated secondary antibodies (goat anti-mouse secondary antibody (Bio-Rad) or goat anti-rabbit secondary antibody (Abcam) ...
-
bioRxiv - Molecular Biology 2022Quote: ... the membranes were probed with first antibodies and followed by a horseradish peroxidase (HRP)-conjugated secondary antibody (Bio-Rad). Blots were visualized by enhanced chemiluminescence (PerkinElmer) ...
-
bioRxiv - Immunology 2023Quote: ... and an OxPhos rodent antibody cocktail (Thermo) with goat anti-mouse or rabbit HRP-conjugated secondary antibodies (both BioRad).
-
bioRxiv - Plant Biology 2020Quote: ... Endpoint analysis and allelic discrimination related to SNP calls were accomplished using the CFX96 Touch™software (BioRad, CA, USA). The DNA of the restorer line Primepi was used as a reference control for Rf3 (Geyer et al ...
-
bioRxiv - Genetics 2021Quote: ... Ras-related GTP binding D (Rragd) (forward, CACCTGAGCTTTTACCTGA; reverse, TCAGCAGATTCTCCAGCGTC) gene expression levels were quantified by SYBR-Green (Bio-Rad) on a CFX96 Real-Time PCR Detection System (Bio-Rad ...
-
bioRxiv - Cell Biology 2023Quote: ... following the procedure of Stoeckius et al.[28] using the LYNX Rapid Streptavidin Antibody Conjugation Kit (Biorad, Ref #LNK163STR). Briefly ...
-
bioRxiv - Immunology 2021Quote: ... Reverse transcription was performed with iScript Reverse Transcription Supermix (Bio-Rad). For lungs ...
-
bioRxiv - Cancer Biology 2023Quote: ... Reverse transcription was performed with the iScript Reverse Transcription kit (BioRad) using 350 ng total RNA extract ...
-
bioRxiv - Molecular Biology 2024Quote: ... for reverse transcription with iScriptTM reverse transcription supermix (Bio-Rad #1708840) and subsequent qPCR with iTaq Supermix (Bio-Rad #1725120) ...
-
bioRxiv - Cell Biology 2024Quote: ... Reverse transcription was performed using iScript Reverse Transcription Supermix (BioRad #1708841) according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2024Quote: ... Reverse transcription was performed with iScript™ Reverse Transcription Supermix (BioRad) according to manufacturer instructions ...
-
bioRxiv - Cell Biology 2024Quote: ... Reverse transcription using the iScript™ Reverse Transcription Supermix (Biorad, #1708841) using 1 μg of total RNA was used to generate cDNAs ...
-
bioRxiv - Cancer Biology 2021Quote: ... 3 µg of total RNA was used in the reverse transcription reaction using the iScript cDNA synthesis kit (Bio-Rad). Quantitative PCR amplification was performed on the Prism 7900 Sequence Detection System (Applied Biosystems ...
-
bioRxiv - Cancer Biology 2021Quote: ... 3 μg of total RNA was used in the reverse transcription reaction using the iScript cDNA synthesis kit (Bio-Rad). Quantitative PCR amplification was performed on the Prism 7900 Sequence Detection System (Applied Biosystems ...
-
bioRxiv - Cancer Biology 2024Quote: ... 3 μg of total RNA was used in the reverse transcription reaction using the iScript cDNA synthesis kit (Bio-Rad). Quantitative PCR amplification was performed on the Prism 7900 Sequence Detection System (Applied Biosystems ...
-
bioRxiv - Bioengineering 2024Quote: Following 30 minutes of nanoparticle treatment,total messenger RNA was isolated from bEND.3 cells using trizol method with TRI Reagent.Following reverse transcription with the iScript cDNA synthesis kit (Bio-Rad), the transcripts were quantified using KAPA SYBR® FAST according to the manufacturer’s instructions in the PCR instrument (BioRad) ...
-
bioRxiv - Microbiology 2020Quote: ... incubated with goat α-rabbit 2° antibody conjugated to HRP (1:5000) (Bio-Rad) in TBS-T at room temperature (1 h) ...
-
bioRxiv - Immunology 2021Quote: ... then anti-mouse IgG secondary antibody conjugated to HRP (172-1011, Bio-Rad Laboratories), diluted 1:5000 in blocking buffer as per manufacturer instructions ...
-
bioRxiv - Cancer Biology 2020Quote: ... secondary HRP-conjugated antibodies before being imaged using ECL substrate (Bio-Rad, 170-5061) on an ImageQuant LAS-4000 (GE Healthcare ...
-
bioRxiv - Cell Biology 2020Quote: ... membranes were incubated 1h with HRP-conjugated secondary antibodies at 1:5,000 (Bio-Rad). After 4 more washes ...
-
bioRxiv - Neuroscience 2021Quote: ... after incubation for 1 hr with HRP-conjugated second antibodies (1:5000, Bio-Rad). Between each step ...
-
bioRxiv - Microbiology 2020Quote: ... Bound antibodies were detected with Goat Anti-mouse-IgG (H+L)-HRP Conjugated (BioRad) and bound conjugate was detected using TMB (Invitrogen/Life technologies ...
-
bioRxiv - Microbiology 2020Quote: ... Band detection was conducted with a goat α-rabbit-HRP secondary antibody (Bio-rad) at 1:10,000 followed by development with Clarity Western ECL Substrate (Bio-rad ...
-
bioRxiv - Molecular Biology 2020Quote: ... a horseradish peroxidase (HRP)-conjugated secondary antibody (goat-anti-rabbit) (Bio-Rad, Cat # 1705046) (1:5000 ...
-
bioRxiv - Immunology 2020Quote: ... were used with HRP-conjugated antibodies and visualized using ChemiDoc-It Imaging system (BioRad). Bands were quantified using ImageJ software.
-
bioRxiv - Cell Biology 2021Quote: ... then incubated in fresh blocking buffer supplemented with a secondary antibody-HRP conjugate (BioRad) at a 1:10000 dilution for at least 1 h at RT ...
-
bioRxiv - Microbiology 2021Quote: ... The membrane was then incubated with anti-rabbit antibody conjugated to HRP (Bio-Rad) (1:8000 in 5% milk+TBS-T ...
-
bioRxiv - Neuroscience 2021Quote: ... Immunoblots were detected with HRP-conjugated secondary antibodies and Clarity Western ECL-substrate (BioRad) and analyzed with the ChemiDoc Imaging system (BioRad) ...