Labshake search
Citations for Bio-Rad :
201 - 250 of 7982 citations for 7 methoxy 4 piperidin 1 ium 1 ylmethyl 3 4 dihydro 2H 1 benzoxepin 5 one chloride since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: ... Data were quantified using a Personal Molecular Imager with Quantity One 1-D analysis software (Bio-Rad) and analyzed with GraphPad Prism 4 software.
-
bioRxiv - Molecular Biology 2023Quote: ... The intensity of the protein bands was quantified by Quantity One 1-D Analysis Software (Bio-Rad). Background subtraction was performed for each band ...
-
bioRxiv - Cancer Biology 2023Quote: ... Blots were visualized using the VersaDoc Imaging System with Quantity One 1-D Analysis software (Bio-Rad).
-
bioRxiv - Molecular Biology 2023Quote: ... and individual band densities were measured and compared using Quantity One 1-D analysis software (Biorad, USA). The resulting values were normalized separately for each set of time points.
-
bioRxiv - Molecular Biology 2024Quote: ... The levels of proteins bound to chromatin were quantified using Quantity One 1-D Analysis Software (BioRad) and normalized with their corresponding Histone H2B values ...
-
bioRxiv - Biochemistry 2024Quote: ... and the band intensities were quantified and analyzed using Quantity One 1-D software (Bio-Rad Laboratories).
-
bioRxiv - Molecular Biology 2022Quote: ... and incubated for 1 h with 5% blotting grade blocker (Bio-Rad). Primary antibodies were incubated overnight at 4℃ and secondary HRP-conjugated antibodies were incubated for 1 h at room temperature ...
-
bioRxiv - Microbiology 2022Quote: ... After 1 h blocking (5% non-fat milk, Bio-Rad 170–6404) at room temperature (RT) ...
-
bioRxiv - Molecular Biology 2019Quote: ... Either regular (Figure 4 and 5) or stain-free (Figure 8 and 9, Bio-Rad #1610182) 10 % acrylamide gels were used ...
-
bioRxiv - Cell Biology 2020Quote: ... then heated at 90°C for 5 min before loading onto 4-20% gel (Bio-Rad). Proteins were separated using running buffer (Bio-Rad ...
-
bioRxiv - Genetics 2022Quote: ... boiled for 5 minutes and resolved on 4 to 20% TGX mini protean gels (Bio-Rad). The proteins were transferred to PVDF membranes using BioRad Trans-Blot semi-dry transfer ...
-
bioRxiv - Bioengineering 2019Quote: ... for 5 min at 95 °C and loaded into a 4– 15% polyacrylamide gel (Bio-Rad). Proteins were transferred to a 0.45 µm PVDF membrane (Bio-Rad ...
-
bioRxiv - Neuroscience 2024Quote: ... 5 μg of sample were loaded on a 4-to-20% SDS polyacrylamide gel (Bio-Rad). Membranes were blocked for 3 hours in 5% milk in TBS (50 mM Trizma base and 150 mM NaCl ...
-
bioRxiv - Immunology 2021Quote: ... The cells were centrifuged at 300G for 7 minutes at 4°C and the cell pellet was resuspended then counted with the BioRad cell counter (Bio-Rad, TC20).
-
bioRxiv - Molecular Biology 2021Quote: ... 4–20% gel (Bio-Rad) using SDS-PAGE ...
-
bioRxiv - Cell Biology 2019Quote: ... 4-20% gradient gels (BioRad) and transferred to 0.2 μm nitrocellulose membranes (BioRad) ...
-
bioRxiv - Cell Biology 2020Quote: ... 0.8 × 4 cm (Bio-Rad). The column was washed with 10 column volumes (c.v. ...
-
bioRxiv - Cell Biology 2020Quote: ... 4-20% TGX gels (BioRad) were used ...
-
bioRxiv - Cell Biology 2021Quote: ... 4-20% gradient (Bio-Rad,); and then proteins were transferred to PVDF membranes ...
-
bioRxiv - Microbiology 2023Quote: ... 4% low-melt agarose (BioRad) was prepared in 100 mM sodium cacodylate buffer and kept liquid at 70 °C until needed ...
-
bioRxiv - Developmental Biology 2023Quote: ... 4-15% (Bio-Rad #4561085), with 1X Tris/Glycine/SDS Buffer (Bio-Rad #1610732) ...
-
bioRxiv - Developmental Biology 2023Quote: ... All cDNA samples were diluted 1:5 and 1 μL was used in quantitative PCR (qPCR) reactions with iTaq Universal SYBR Green Supermix (Bio-Rad, #1725124), according to manufacturer’s instruction and using the Applied Biosystems QuantStudio 7 flex qPCR System ...
-
bioRxiv - Cell Biology 2022Quote: ... in PBS and incubated overnight at 4°C in primary antibodies: anti-human actin-β primary monoclonal antibody produced in mouse (1:100; Bio-Rad Laboratories Inc. MCA57766A) and non-muscle myosin II produced in rabbit (1:100 ...
-
bioRxiv - Cell Biology 2021Quote: ... pH 9.5). Quantification of Western blot images (SFig. 1-4) was carried out using ChemiDoc™ XRS+ Image Lab™ Software (Bio-Rad Laboratories AB, Sweden); statistical analysis was performed with GraphPad Prism software (version 5.0 ...
-
bioRxiv - Neuroscience 2022Quote: ... and protein standards were mixed with Laemmli buffer and loaded on 4-15% Criterion TGX Stain-Free protein gels in 1×□TGS running buffer (all from Bio-Rad, Marnes-la-Coquette, France) and transferred to a 0.20μm PVDF membrane with the Trans-Blot Turbo RTA Midi Transfer Kit (Bio-Rad ...
-
bioRxiv - Cancer Biology 2021Quote: ... and 3 μg of protein was separated on 4% to 20% precast polyacrylamide gels (Bio-Rad, cat # 4561095) for detection of histone H3 andH3K27me3 ...
-
bioRxiv - Molecular Biology 2023Quote: 4–8 μl of samples and 3 μl of Precision Plus Protein Dual Color Standard (1610374, Bio-Rad) were loaded into 4–12% Bis-Tris Bolt gels (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2022Quote: ... Slides were blocked overnight at 4°C in PBS with 3% BSA and 10% donkey serum (Bio-Rad), stained with DAPI (ThermoFisher ...
-
bioRxiv - Plant Biology 2020Quote: ... The mixture was kept for 5 min at 95°C and 5 min on ice before loading on a TGX 4-20% Strainfree (Bio-Rad US) gel immersed in TGS 1X buffer ...
-
bioRxiv - Developmental Biology 2019Quote: ... Gr-1 (1:500, MCA2387, Bio-Rad), Fluorescein labeled DBA-lectin (1:500 ...
-
bioRxiv - Immunology 2023Quote: ... 5’ GACGTGGGCTCCTTACACTGA 3’)(41) and 18s (Fwd: 5’ CTTAGAGGGACAAGTGGCG 3’, Rev: 5’ ACGCTGAGCCAGTCAGTGTA 3’)(42) using the SsoFast assay system (BioRad) was used to quantify transcripts in a BioRad CFX94 machine.
-
bioRxiv - Cancer Biology 2020Quote: ... Lysates were run on 4–15% or 4-20% Mini-protean TGX gels (Bio-Rad) and transferred onto ImmobilonTM membranes (MilliporeSigma ...
-
bioRxiv - Systems Biology 2021Quote: ... Immunoprecipitated proteins (4 μl) were resolved on 4-20% Criterion Tris-HCl Precast gels (BioRad) and visualized by silver stain (Pierce Silver Stain Kit ...
-
bioRxiv - Microbiology 2024Quote: ... using precast 4-20 % polyacrylamide gels (4-20 % CriterionTM TGX BioRadTM, BIO-RAD, Hercules, USA).
-
bioRxiv - Microbiology 2024Quote: ... Screens were analyzed using a Molecular Imager FX and the Quantity One 1-D Analysis Software (Bio-Rad).
-
bioRxiv - Cell Biology 2019Quote: ... and densitometric analysis was performed using the Gel Doc 2000 Gel Documentation System and Quantity One version 4 software (BioRad, CA, USA). The β-tubulin signal was used to normalize protein levels.
-
bioRxiv - Immunology 2021Quote: ... Basically 300 ug of IVIG protein were subjected to isoelectric focusing (IPG) across pH gradients of 4-7 (Biorad, LifeSciences, Hercules, Ca, USA) or pH 6-11 (GE Healthcare ...
-
bioRxiv - Neuroscience 2019Quote: ... After being blocked with TBST (1%) containing 5% blotting-grade blocker (Bio-Rad), the membranes were incubated overnight with primary antibodies against target molecules at 4 °C ...
-
bioRxiv - Cell Biology 2020Quote: ... anti-alpha-Tubulin (rat, YL1/2, MCA77G, Bio-Rad, 1:2000 (Figure 5) or 1:10000 (other figures) ...
-
bioRxiv - Cancer Biology 2019Quote: ... Membranes were blocked in 5% nonfat dry milk for 1 hour (Bio-Rad) and incubated gently shaking overnight at 4°C in 1° antibody/PBS-T ...
-
bioRxiv - Microbiology 2020Quote: ... and blocked for 1 h with 5% non-fat milk (Bio-Rad Laboratories) or BSA (Sigma-Aldrich) ...
-
bioRxiv - Bioengineering 2021Quote: ... Membranes were blocked for 1 h with 5% nonfat milk powder (Bio-Rad) in TBS + 0.05% Tween-20 (Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2022Quote: ... 1% Tween]) or for 5 min in EveryBlot blocking buffer (Bio-Rad, #12010020) before proceeding to primary and HRP secondary antibody staining in the respective blocking buffers ...
-
bioRxiv - Microbiology 2023Quote: ... sheep polyclonal anti-GFP (Bio-Rad, 4745-1051, 1:1000, 5 µg/mL), and rabbit polyclonal anti-GFP (Novus Biologicals ...
-
bioRxiv - Cell Biology 2020Quote: ... which then heated at 90°C for 5 min before loading onto 4-20% gel (Bio-Rad). Proteins were separated using running buffer (Bio-Rad ...
-
bioRxiv - Neuroscience 2020Quote: ... Denatured protein lysates (5 μg) were loaded in 4–20% Criterion TGX Precast Gels (Bio-Rad, 5678095) and transferred to Immobilon-FL PVDF membrane (0.45 μm pore ...
-
bioRxiv - Cancer Biology 2020Quote: ... and incubated overnight at 4°C with primary antibodies dissolved in 5% Blotting-Grade Blocker (Bio-Rad). All primary antibodies and dilutions used are listed in Supplementary Table STm.1 ...
-
β-amyloid−driven synaptic depression requires PDZ protein interaction at AMPA-receptor subunit GluA3bioRxiv - Neuroscience 2021Quote: ... boiled for 5 min and loaded on a 4-15% Criterion TGX Stain-Free precast gel (BioRad). Protein samples were transferred unto a PVDF membrane (BioRad ...
-
bioRxiv - Immunology 2021Quote: ... All samples were acquired on a ZE5 5-laser or 4-laser cell analyzer (Bio-rad laboratories) and analyzed with FlowJo software (Tree Star) ...
-
bioRxiv - Genomics 2023Quote: ... 10% glycerol) containing 5% ß-mercaptoethanol before SDS-PAGE on a 4-15% polyacrylamide gel (Bio-Rad). Proteins were transferred onto a nitrocellulose membrane blocked with AdvanBlock-Chemi blocking solution (Advansta ...