Labshake search
Citations for Bio-Rad :
201 - 250 of 558 citations for 6 Methylheptyl 8 methylnonyl phthalate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2020Quote: ... The adaptor was cleaned up on a Micro Bio-Spin 6 chromatography column (Bio-Rad) equilibrated with water ...
-
bioRxiv - Microbiology 2019Quote: ... Excess [γ-32P] ATP was removed with a Bio-Spin 6 column (Bio-rad, CITY). Followed by heat inactivation ...
-
bioRxiv - Biochemistry 2022Quote: ... with the mini profinity IMAC and mini Bio-Gel P-6 desalting cartridges (Bio-Rad). The protein concentration and purity were verified by Bradford Protein Assay (Bio-Rad ...
-
bioRxiv - Biochemistry 2022Quote: ... 10mM BME) at room temperature using Micro Bio-Spin 6 columns (Bio-Rad CAT# 7326200). PARLSkd3 concentration was measured via A280 and the molar extinction coefficient and PARLSkd3 concentration was adjusted to 30 μM ...
-
bioRxiv - Developmental Biology 2019Quote: ... and 6 μl freshly prepared Ammonium persulfate (Bio-Rad, 10 mg in 100μl distilled water) were added to the solution and mixed ...
-
bioRxiv - Neuroscience 2020Quote: ... and 10 μg of protein was loaded onto an acrylamide gel (6–15%; Bio-Rad). Gel electrophoresis was performed in Tris- glycine-sodium dodecyl sulfate (SDS ...
-
bioRxiv - Biochemistry 2021Quote: ... Bio-Beads SM-2 Resin and Bio-Gel P-6 were obtained from Bio-Rad Laboratories Inc ...
-
bioRxiv - Animal Behavior and Cognition 2021Quote: ... Labeled probes were then purified using Micro Bio-Spin 6 Chromatography Column (BioRad, Berkeley, CA), and 1 μl of the probe was counted for subsequent radioactivity dilution calculations ...
-
bioRxiv - Biophysics 2020Quote: ... 0.5% n-dodecyl-β-D-maltoside using a Bio-Spin 6 desalting column (Bio-Rad). CmeC (5 μM ...
-
bioRxiv - Genomics 2020Quote: ... cDNA was diluted 1:6 and run with iTaq Universal SYBR Green Supermix (Bio-Rad) on ViiA 7 Real-Time PCR System according to manufacturer protocol ...
-
bioRxiv - Biophysics 2022Quote: ... The modified probes were purified using a P-6 Micro Bio-Spin Column (Bio-Rad).
-
bioRxiv - Molecular Biology 2023Quote: ... The RNA probe was purified using Micro Bio-Spin™ P-6 Gel Columns (Biorad), denatured 5 min in 95°C and cooled on ice ...
-
bioRxiv - Immunology 2022Quote: ... using the magnetic rack (6-Tube SureBeads™ Magnetic Rack #1614916 BIORAD Hercules, CA, USA) to magnetized them ...
-
bioRxiv - Microbiology 2023Quote: ... anti-CD45-APC (clone UM16-6, LYNX Rapid APC Antibody Conjugation Kit, both Bio-rad) and thrombocyte marker K1-PE (LYNX Rapid RPE Antibody Conjugation Kit ...
-
bioRxiv - Cancer Biology 2021Quote: After running through 8% SDS-polyacrylamide (SDS-PAGE; made in house) by gel electrophoresis (BioRad, Hercules, CA, USA), the proteins were transferred ...
-
bioRxiv - Genomics 2021Quote: ... The proteins were separated in the first dimension on 4-7 and 5-8 IPG strips (Bio-Rad). The strips were then loaded onto 8-20% gradient PAGE for separation on the second dimension ...
-
bioRxiv - Microbiology 2019Quote: ... Total cell lysates were separated on 8-12% SDS-PAGE gels and transferred to PVDF membranes (Bio-Rad). Membranes were blocked with TBST with 5% (w/v ...
-
bioRxiv - Genomics 2021Quote: ... were resolved on 8-12% Tris-glycine SDS-polyacrylamide gels and transferred to nitrocellulose blotting membranes (Bio-Rad), following standard procedures ...
-
bioRxiv - Microbiology 2021Quote: ... Cell lysates and virion lysates were resolved on 8 to 16% Mini-Protean TGX precast gels (Bio-Rad), transferred onto nitrocellulose membranes (GE Healthcare ...
-
bioRxiv - Plant Biology 2021Quote: ... were loaded onto an 8-channel DG8TM cartridge for droplet generation in the QX200 Droplet Generator (Bio-Rad). Droplets were transferred into a 96-well plate (Bio-Rad ...
-
bioRxiv - Cell Biology 2021Quote: ... SDS-PAGE was performed using 8-16% gradient gel and transferred to nitrocellulose paper using the Transblot (BioRad). Western blots were carried out using iBind with 1 ug/ml primary antibodies and 1 ug/ml secondary antibodies following iBind protocol (Invitrogen/ThermoFisher).
-
bioRxiv - Genomics 2020Quote: ... quantifying 8 mRNAs and 10 circRNAs of interest with the SsoAdvanced™ Universal SYBR Green Supermix (BioRad, USA). All reactions were performed in 384-well plates on the LightCycler480 instrument (Roche ...
-
bioRxiv - Biochemistry 2021Quote: ... samples were buffer exchanged into 150 mM of ammonium acetate pH 8 using Bio-Spin P6 columns (BioRad) and the final protein concentrations were adjust to 1-5 µM ...
-
bioRxiv - Microbiology 2022Quote: ... Cell lysates and virion lysates were resolved on 8 to 16% Mini- Protean TGX precast gels (Bio-Rad), transferred onto nitrocellulose membranes (GE Healthcare ...
-
bioRxiv - Immunology 2020Quote: ... 8 ng of granuloma protein was loaded per lane into Any kD Mini-PROTEAN TGX gels (Bio-Rad), separated by SDS-PAGE and transferred to 0.2 μm nitrocellulose membranes (Bio-Rad) ...
-
bioRxiv - Synthetic Biology 2021Quote: ... serum insulin was performed using the Bio-Plex Pro Mouse Diabetes 8-Plex Assay (Bio-Rad, Hercules, CA) as per the manufacturer’s protocol.
-
bioRxiv - Physiology 2022Quote: ... The 8% equivalent of each fraction by volume was run on a 4-15% TGX gel (Bio-Rad) for Western blotting using affinity-purified polyclonal rabbit anti-mouse Prdm13 ...
-
bioRxiv - Molecular Biology 2022Quote: ... 8 μl from each sample were loaded onto Mini Protean TGX Pre-cast 4-15% gels (Bio-Rad) and migration was carried out for approximately 45 min at 150V ...
-
bioRxiv - Molecular Biology 2023Quote: 4–8 μl of samples and 3 μl of Precision Plus Protein Dual Color Standard (1610374, Bio-Rad) were loaded into 4–12% Bis-Tris Bolt gels (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2023Quote: gp120 or SOSIP glycoproteins were separated on 8–16% SDS-PAGE (mini-PROTEAN TGX protein gels; Bio-Rad) and transferred to a 0.45 μm nitrocellulose membrane (catalog number 1620115 ...
-
bioRxiv - Genomics 2023Quote: ... the ligation products were amplified by 8 cycles of PCR on an S1000 thermocycler (Bio-Rad, Hercules, CA) using Q5 High-Fidelity PCR master mix with HF buffer (NEB Ipswich ...
-
bioRxiv - Biochemistry 2024Quote: ... The supernatant from two reactions were collected and separated by Criterion XT Tris Acetate 3-8% (Bio-rad) SDS-PAGE and visualized by silver staining.
-
bioRxiv - Biophysics 2024Quote: ... 20 µL of the supernatant was taken and added to 8 µL 4X Laemmli sample buffer (Bio-Rad) and 12 µL of 8M urea ...
-
bioRxiv - Molecular Biology 2021Quote: ... 150 mM NaCl and 1mM DTT using Micro Bio-SpinTM P-6 Gel Columns (Bio-Rad). Protein concentration was determined by NanoDrop ...
-
bioRxiv - Molecular Biology 2019Quote: ... While 6-FAM labelled constructs were directly visualized under UV in gel documentation system (Bio-Rad), unlabelled constructs were visualized after staining with ethidium bromide (EtBr).
-
bioRxiv - Biophysics 2019Quote: ... P-6 (7326221) and P-30 (7326223) Micro Bio-Spin columns were obtained from Bio-Rad.
-
bioRxiv - Biochemistry 2019Quote: ... The supernatant was collected and DTT was removed by a Bio-Spin 6 column (Bio-rad) which was pre-equilibrated with 50 mM NaPi ...
-
bioRxiv - Genetics 2021Quote: ... The free [γ-32P]ATP was removed by the use of Bio-Spin 6 column (Biorad) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2020Quote: ... 0.03% (w/v) DDM) using a centrifugal buffer exchange device (Micro Bio-Spin 6, Bio-Rad) as previously described43 ...
-
bioRxiv - Biochemistry 2021Quote: ... and analyzed by Image Lab software (Bio-Rad, SOFT-LIT-170-9690-ILSPC-V-6-1). To measure the +1-frameshifting efficiency ...
-
bioRxiv - Cancer Biology 2022Quote: ... Labeled antibodies were purified by size exclusion chromatography using Bio-Spin 6 columns (Bio-Rad, 7326200) followed by measurement of protein concertation using Nanodrop 2000 at 260 nm.
-
bioRxiv - Cell Biology 2022Quote: ... Following cleanup of the sgRNAs using Micro Bio-Spin 6 columns (#7326221; Bio-Rad, Hercules, CA) and quantification ...
-
bioRxiv - Biochemistry 2020Quote: ... the samples were passed through a Micro Bio-Spin 6 Chromatography column (Bio-Rad, Cat#7326222), sonicated ...
-
bioRxiv - Biophysics 2021Quote: ... Excess Sulfo-SMCC was removed three times by gel filtration (Micro BIO- SPIN P-6, Biorad), mixed with thiol-modified DNA oligonucleotide (CTCTCCTCTCCACCATATCCA ...
-
bioRxiv - Biochemistry 2021Quote: ... Bio-Scale Mini Bio-Gel P-6 desalting cartridge was obtained from Bio-Rad (Hercules, CA). All UV-Vis measurements were taken using Cary 100 Bio UV-Vis from Agilent (Santa Clara ...
-
bioRxiv - Molecular Biology 2021Quote: ... PCR products were separated on nondenaturated 6% polyacrylamide gels and imaged by ChemiDoc system (Bio-Rad).
-
bioRxiv - Biophysics 2021Quote: ... AM2 was exchanged into each of these detergent solutions using Bio-Spin 6 columns (Bio-Rad) and diluted to a final concentration of 50 µM (per monomer ...
-
bioRxiv - Cell Biology 2022Quote: ... Densitometric analysis of protein levels were performed using the Image Lab 6 Software (Bio-Rad Laboratories).
-
bioRxiv - Neuroscience 2022Quote: ... The cytokine levels were calculated by standard curve and analyzed using microplate manager 6 software (BioRad). Cytokines were measured with MSD plates and performed according to the manufacturer’s instructions.
-
bioRxiv - Biophysics 2023Quote: ... Viroporins were exchanged into each of these ammonium acetate solutions using BioSpin 6 columns (Bio-Rad) and diluted to a final protein concentration of 20 μM (per monomer ...