Labshake search
Citations for Bio-Rad :
201 - 250 of 7998 citations for 6 Chloro 2 methyl 1 2 4 triazolo 4 3 b pyridazin 3 2H one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2024Quote: ... using precast 4-20 % polyacrylamide gels (4-20 % CriterionTM TGX BioRadTM, BIO-RAD, Hercules, USA).
-
bioRxiv - Cell Biology 2019Quote: ... and densitometric analysis was performed using the Gel Doc 2000 Gel Documentation System and Quantity One version 4 software (BioRad, CA, USA). The β-tubulin signal was used to normalize protein levels.
-
bioRxiv - Biochemistry 2020Quote: ... Biobeads SM-2 (Biorad; 2 g; prewashed in nanodisc buffer) were added ...
-
bioRxiv - Immunology 2022Quote: ... samples were mixed 1:1 with 2 x native sample buffer (BioRad) and loaded on a 4-20% precast protein gel (BioRad ...
-
bioRxiv - Genomics 2020Quote: ... 2% CleanCut (BioRad) agarose was melted at 70°C then cooled to 50°C ...
-
bioRxiv - Biochemistry 2021Quote: KirBac3.1 protein was buffer-exchanged to 200 mM ammonium acetate (pH=8.0) with 0.5% C8E4 (2×CMC) using a Biospin-6 column (BioRad). The protein sample was loaded into a gold coated needle prepared in-house and analysed on a modified Q-Exactive mass spectrometer (Thermo Fisher Scientific) ...
-
bioRxiv - Biochemistry 2023Quote: ... Protein was then cleaned 2-times on Micro Bio-Spin™ P-6 gel Columns (BioRad, #732-6221) where buffer was exchanged with phase separation buffer ...
-
bioRxiv - Biochemistry 2019Quote: ... 25 mg ml−1 Bio-Beads SM-2 (Bio-Rad) was added and incubated at 4°C for 1 h ...
-
bioRxiv - Biochemistry 2020Quote: ... diluted 2:1 in 4X Laemmli sample buffer (Bio-Rad) containing 100 mM Dithiothreitol (CAS No ...
-
bioRxiv - Microbiology 2022Quote: ... Capacitors were 1-cm Tygon tubing (2 mm ID, BioRad), having Luer connectors on each extremity ...
-
bioRxiv - Microbiology 2023Quote: ... and β-tubulin (clone YL1/2, Bio-Rad; 1:5000) antibodies at 4°C overnight ...
-
bioRxiv - Molecular Biology 2020Quote: ... IB analysis was performed after 6-7.5% SDS-PAGE or 4-20% Mini-PROTEAN TGX Precast Protein Gels (BioRad, Hercules, CA), with overnight incubation with a 1:1000 dilution of primary antibody and followed by a 1:5000 dilution of horseradish peroxidase-conjugated anti-rabbit or anti-mouse antibody (Jackson ImmunoResearch ...
-
bioRxiv - Microbiology 2019Quote: ... 4 µl of the diluted DNA sample was added to 6 µl of a mixture containing SYBR Green Supermix (Bio-Rad) and gene-specific primers (0·4 µM total ...
-
bioRxiv - Biophysics 2021Quote: ... the mix contained 4% acrylamide (BioRad), 0.03% BisAcrylamide (BioRad) ...
-
bioRxiv - Cell Biology 2020Quote: ... precast 4-18% gradient gels (BioRad). Recombinant N-terminally acetylated α- ...
-
bioRxiv - Cell Biology 2022Quote: ... 4%-20% gradient gels (Bio-Rad) were used for Sml1 blots and 4%-15% gradient gels (Bio-Rad ...
-
bioRxiv - Biochemistry 2021Quote: ... 4× Laemmli Sample Buffer (Bio-Rad) was added and samples were run in SDS-PAGE without extra elution steps ...
-
bioRxiv - Biochemistry 2020Quote: ... 4–20% gradient gels (Bio-Rad), and protein bands were visualized with Coomassie Brilliant Blue (Bio-Rad ...
-
bioRxiv - Cancer Biology 2019Quote: ... 4% CHAPS and deStreak (BIORAD, Australia). Two equilibration steps were carried out in SDS equilibration buffer consisting of SDS ...
-
bioRxiv - Developmental Biology 2019Quote: ... Lastly 4 μl TEMED (Bio-Rad) and 6 μl freshly prepared Ammonium persulfate (Bio-Rad ...
-
bioRxiv - Molecular Biology 2019Quote: ... or 4-20% precast gels (BioRad). Gels were transferred onto Immobilon-P PVDF membrane (EMD Millipore) ...
-
bioRxiv - Genetics 2021Quote: ... 4% goat/donkey serum (Bio-Rad Laboratories ...
-
bioRxiv - Cancer Biology 2023Quote: 4–20% polyacrylamide gels (Bio-Rad) were used for protein separation ...
-
bioRxiv - Immunology 2023Quote: ... 4-12% Tris-HCl (Bio-Rad) with XT MOPS running buffer (Bio-Rad) ...
-
bioRxiv - Cell Biology 2023Quote: ... 4-15% gel (Bio-Rad, #4568086). Transfer and Western Blotting was performed as described above ...
-
bioRxiv - Molecular Biology 2024Quote: ... at 4°C (Bioruptor Pico, BioRad). Then ...
-
bioRxiv - Bioengineering 2020Quote: ... 1 µg of each protein sample was separated in one dimension using 4-20% tris-glycine gels (Mini-PROTEAN TGX, Bio-Rad Laboratories, Inc.). A 1:6 dilution of the PageRuler Plus pre-stained protein ladder (10 µl ...
-
bioRxiv - Molecular Biology 2023Quote: ... for 1 h at 4°C in a sealed gravity column (Bio-Rad). The beads on the gravity column were washed with 50 ml of high-salt wash buffer (20 mM HEPES ...
-
bioRxiv - Neuroscience 2024Quote: ... consisting of 4% (vol/vol) of 19:1 acrylamide/bis-acrylamide (BioRad, 1610144), 60 mM Tris⋅HCl pH 8 (ThermoFisher ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... gene expression was normalized with the housekeeping gene Act5c (primers: 5’ –gcgcccttactctttcacca-3’ and 5’ - atgtcacggacgatttcacg-3’. We performed the RT-qPCR analysis with SYBR Green (BioRad) or qPCRBIO SyGreen Blue Mix LO-ROX (PCR BIOSYSTEMS ...
-
bioRxiv - Systems Biology 2020Quote: ... Slides were washed with PBS (3 times, 3 min) and developed using the BCIP-NBT detection system (Bio-Rad Laboratories) for 12 min followed by washing with PBS (3 times ...
-
bioRxiv - Molecular Biology 2022Quote: ... (2) post-AP beads were washed twice in 500μl 2% SDS wash buffer (2% v/v SDS (BioRad, #1610418), 150mM NaCl ...
-
bioRxiv - Biochemistry 2019Quote: ... supplemented with 0.02% pI 3-10 ampholites (BioRad). Isoelectric focusing was performed in a Protean™ IEF cell (Bio-Rad ...
-
bioRxiv - Cell Biology 2021Quote: ... After 3 washes with 0.05% tween20 (Bio-Rad) in TBS buffer (Bio-Rad) ...
-
bioRxiv - Biochemistry 2020Quote: ... The purified MCU-EMRE subcomplex in DDM was then reconstituted into nanodisc by incubating with Msp1 protein, lipids (POPC:POPE:POPG, 3:1:1 molar ratio) and BioBeads (BioRad) at 4°C ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... We used 1 μL diluted cDNA (1:3 in ddH2O) and iTaq Universal SYBR Green Supermix (Bio-rad) in the Bio-rad CFX96 real-time PCR detection system for qPCR experiments ...
-
bioRxiv - Cancer Biology 2020Quote: ... Protein samples were diluted (3:1) with a 4x Laemmli sample buffer (Biorad, Cat# 1610747) and heated at 98 °C for 5 min ...
-
bioRxiv - Bioengineering 2023Quote: ... for 1–3 hours at 100 V and then transferred to PVDF membrane (Bio-Rad) at 40 V for 2–8 hours ...
-
bioRxiv - Neuroscience 2020Quote: ... Proteins were separated on 4%-15% or 4%-20% Criterion TGX precast protein gels (64134751; Bio-Rad), and transferred to an Immun-Blot PVDF membrane (1620177 ...
-
bioRxiv - Molecular Biology 2022Quote: ... at a 1:5 w/w ratio for 2 hours before addition of 100 mg mL-1 Bio-Beads SM-2 resin (Bio-Rad) and then incubated overnight at 4 °C with gentle agitation to remove detergent ...
-
bioRxiv - Microbiology 2023Quote: ... The reaction mixtures contained 100 ng RNA template per sample diluted 2-fold with qPCR solution (iTaq Universal SYBR Green One-Step Kit, Bio-Rad) containing the primers D2S and D2C ...
-
bioRxiv - Developmental Biology 2021Quote: ... Additional pre-absorption controls were performed in which the anti-IL-6 antibody was incubated overnight at 4 °C with a 10 fold molar excess of recombinant chicken IL-6 (1.67 μM; Bio-Rad Laboratories, Inc.) before immunolabeling fixed sections of chick ocular tissues ...
-
bioRxiv - Neuroscience 2019Quote: ... 5uL of the sample was loaded into 4-6% polyacrylamide gel along with Precision Plus Protein™ Dual Color Standard (#1610374S, Bio-Rad) and was run at 120 V ...
-
bioRxiv - Genomics 2023Quote: ... The nuclei were isolated from cell homogenate by centrifugation and counted on an automated cell counter (TC20 BioRad, range 4-6 um). Transposition of 100k (weeks 1 ...
-
bioRxiv - Genetics 2022Quote: ... reverse 5’ - CACGTGGGACCGCTCGTCTCC) and MUC3B-specific primers (forward 5’ CGGGGGCCAGTGGGATGGCCTCAAG-3’; reverse 5’-CACGCGGGACCGCTCGTCTCT-3’) using SsoFast EvaGreen Supermix (#1725200, Bio-Rad) on a CFX96 Real-Time PCR Detection System (Bio-Rad ...
-
bioRxiv - Immunology 2022Quote: ... and mouse hypoxanthine-guanine phosphoribosyltransferase gene (Hprt) (forward, 5’-GGACTTGAATCAAGTTTGTG-3’; reverse, 5’-CAGATGTTTCCAAACTCAAC-3’) in a CFX96 Real-Time PCR Detection System (Bio-Rad). The qRT-PCR results were analyzed using the ΔCt method (relative expression ...
-
bioRxiv - Microbiology 2019Quote: ... of total 16S rRNA gene copies was carried out in triplicate 10µL reactions with 200nM 891F(5’-TGGAGCATGTGGTTTAATTCGA-3’)/1003R(5’-TGCGGGACTTAACCCAACA-3’) primers using a BioRad CFX384 thermocycler with iTaqTM Universal Probes Supermix (BioRad 1725132) and probe 1002P ([Cy5]CACGAGCTGACGACARCCATGCA[BHQ3] ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... 5’-TAA TCA GAC AAG GAA CTG ATT A-3’ // Reverse: 5’-CGA AGG TGT GAC TTC CAT G-3’) and CFX96 Touch Real-Time PCR Detection System (Bio-Rad).
-
bioRxiv - Microbiology 2023Quote: ... US28 (sense, 5’-CCAGAATCGTTGCGGTGTCTCAGT-3’; antisense, 5’-CGTGTCCACAAACAGCGTCAGGT-3’) and GAPDH were detected with CFX Connect Real Time System (Bio-Rad) using iTaq Universal SYBR Green Supermix (Bio-Rad) ...
-
bioRxiv - Microbiology 2023Quote: ... and primer set previously described [25] CtPl+ 5’-TAGTAACTGCCACTTCATCA-3’ and CtP2 5’-TTCCCCTTGTAATTCGTTGC-3’) and using a CFX96TM real-time thermocycler (Bio-Rad)) ...