Labshake search
Citations for Bio-Rad :
201 - 250 of 1488 citations for 6 Benzyloxy 1H indole 2 boronic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... An Aminex HPX-87H Organic Acid Analysis Column (300 × 7.8 mm; Bio-Rad, Hercules, CA, USA) was equilibrated with 5 mM H2SO4 (Titrisol ...
-
bioRxiv - Cancer Biology 2023Quote: Nucleic acids (RNA or DNA) samples were loaded in Bio-Dot SF Microfiltration Apparatus (Bio-Rad) and allowed to bind onto the membrane ...
-
bioRxiv - Immunology 2024Quote: ... 10mL of 10% (v/v) acetic acid was incubated in poly-prep chromatography columns (Bio-Rad) for 20 minutes ...
-
bioRxiv - Developmental Biology 2020Quote: ... complemented with 2-mercaptoethanol (Bio-rad) and heated at 95 °C for 5 minutes ...
-
bioRxiv - Neuroscience 2021Quote: ... supplemented with 2-mercaptoethanol (Bio-Rad).
-
bioRxiv - Biochemistry 2020Quote: ... Bio-Beads SM-2 (Bio-rad) were supplemented into the mixture to remove the detergent ...
-
bioRxiv - Biochemistry 2022Quote: ... supplemented with 2-mercaptoethanol (Bio-Rad) and subjected to western blotting (WB ...
-
bioRxiv - Biophysics 2021Quote: ... bio-beads SM-2 (Bio-Rad) were added to the mixture and rotated overnight at 4 °C ...
-
bioRxiv - Cell Biology 2021Quote: ... 25 μL bis-acrylamide 2% (BioRad), 137 μL acrylamide 40% (BioRad) ...
-
bioRxiv - Cell Biology 2021Quote: ... 20 μL bis-acrylamide 2% (BioRad), 70 μL acrylamide 40% (BioRad) ...
-
bioRxiv - Cell Biology 2021Quote: ... 2×Laemmli buffer (Bio-Rad Laboratories) supplemented with β-mercaptoethanol was added to the beads ...
-
bioRxiv - Neuroscience 2022Quote: ... 100 µM 2-mercaptoethanol (Bio-Rad), DMEM/F-12 (Invitrogen) ...
-
bioRxiv - Biophysics 2020Quote: Bio-Beads SM-2 (Bio-Rad) were prepared ∼400 uL biobeads ...
-
Peripheral neuropathy linked mRNA export factor GANP reshapes gene regulation in human motor neuronsbioRxiv - Neuroscience 2021Quote: ... in 2-mercaptoethanol (#1610710, Bio-Rad). Gel was transferred into a nitrocellulose membrane (#1704158 ...
-
bioRxiv - Bioengineering 2020Quote: ... anti-YL1/2 (1:1000, BioRad) primary antibodies ...
-
bioRxiv - Biochemistry 2020Quote: ... BioBeads SM-2 (Bio-Rad Laboratories) in the amount of 0.6 g per 1 mL were added to the reconstruction mixture and the resulted mixes were incubated for 2 hours at 4°C for DMPC nanodiscs and 4 hours at 4°C for POPG and DMPC:POPG (50:50 ...
-
bioRxiv - Bioengineering 2021Quote: ... and 2% bis-acrylamide (BioRad 1610143) solutions were diluted in ultrapure water at varying concentrations to yield hydrogels of varying stiffness ...
-
bioRxiv - Cell Biology 2021Quote: ... and 2-mercaptoethanol (Bio-Rad, 1610710). Lysates were resolved on SDS polyacrylamide gels and blotted onto PVDF membranes using Trans-Blot Turbo RTA Midi 0.45 μm LF PVDF Transfer Kit (Bio-Rad ...
-
bioRxiv - Cancer Biology 2020Quote: ... containing 2-merchatoethanol (#1610710, Bio-Rad) and boiling at 95°C for 10 minutes ...
-
bioRxiv - Cell Biology 2021Quote: ... and 2-Mercaptoethanol (BioRad, cat # 1610710) and boiled at 95°C for 5 minutes ...
-
bioRxiv - Systems Biology 2022Quote: ... 2 µL propidium iodide (BioRad, 1351101) was added to the single-cell suspension and sorting was performed on the PI-negative live cell population using fluorescent-activated cell sorting (FACS) ...
-
bioRxiv - Neuroscience 2024Quote: ... supplemented with 2-mercaptoethanol (Bio-Rad).
-
bioRxiv - Cell Biology 2024Quote: ... and 2% Bis-Acrylamide (Bio-Rad) with milliQ water as described elsewhere 38 ...
-
bioRxiv - Biochemistry 2024Quote: ... Bio-Beads SM-2 (Bio-Rad) were activated with methanol ...
-
bioRxiv - Cell Biology 2023Quote: ... 66 µl 2% bisacrylamide (Bio-Rad), 334 µl water for a final concentration of 12.5% acrylamide and 3.75% bisacrylamide in water ...
-
bioRxiv - Bioengineering 2024Quote: ... 2% Bis-Acrylamide solution (BIORAD, #1610142), and distilled water was blended and adjusted to manufacture PA gels with varying rigidity ...
-
bioRxiv - Biochemistry 2022Quote: ... Biobeads SM-2 resin (Bio-Rad) was added at a ratio of 1:5 (w/v) ...
-
bioRxiv - Immunology 2022Quote: ... and SM-2 beads (Bio-Rad) as previously described (9) ...
-
bioRxiv - Neuroscience 2023Quote: ... supplemented with 2-mercaptoethanol (Bio-Rad).
-
bioRxiv - Cell Biology 2022Quote: ... with 2-mercaptoethanol (BIO-RAD, 1610710) was added to the samples which were heated (95°C ...
-
bioRxiv - Biophysics 2023Quote: ... and bis-acrylamide (2% solution, BioRad) were polymerized by addition of 0.1%(v/v ...
-
bioRxiv - Immunology 2023Quote: ... Kallestad HEp-2 slides (BIO-RAD) were stained overnight with 1µL of serum from either Lyn-/-IgD+/- or wildtype mice ...
-
bioRxiv - Biophysics 2024Quote: ... Bio-Beads SM-2 (Bio-Rad) were added to the mixture ...
-
bioRxiv - Biochemistry 2024Quote: ... Bio-Beads SM-2 (BIO-RAD) where added to the mixture to remove detergent ...
-
bioRxiv - Cancer Biology 2024Quote: ... and 10% 2-Mercaptoethanol (Bio-Rad). After boiling at 95°C for 5 minutes ...
-
bioRxiv - Molecular Biology 2021Quote: ... 150 mM NaCl and 1mM DTT using Micro Bio-SpinTM P-6 Gel Columns (Bio-Rad). Protein concentration was determined by NanoDrop ...
-
bioRxiv - Genetics 2021Quote: ... The free [γ-32P]ATP was removed by the use of Bio-Spin 6 column (Biorad) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2020Quote: ... 0.03% (w/v) DDM) using a centrifugal buffer exchange device (Micro Bio-Spin 6, Bio-Rad) as previously described43 ...
-
bioRxiv - Biochemistry 2021Quote: ... and analyzed by Image Lab software (Bio-Rad, SOFT-LIT-170-9690-ILSPC-V-6-1). To measure the +1-frameshifting efficiency ...
-
bioRxiv - Cancer Biology 2022Quote: ... Labeled antibodies were purified by size exclusion chromatography using Bio-Spin 6 columns (Bio-Rad, 7326200) followed by measurement of protein concertation using Nanodrop 2000 at 260 nm.
-
bioRxiv - Cell Biology 2022Quote: ... Following cleanup of the sgRNAs using Micro Bio-Spin 6 columns (#7326221; Bio-Rad, Hercules, CA) and quantification ...
-
bioRxiv - Biochemistry 2020Quote: ... the samples were passed through a Micro Bio-Spin 6 Chromatography column (Bio-Rad, Cat#7326222), sonicated ...
-
bioRxiv - Biophysics 2021Quote: ... Excess Sulfo-SMCC was removed three times by gel filtration (Micro BIO- SPIN P-6, Biorad), mixed with thiol-modified DNA oligonucleotide (CTCTCCTCTCCACCATATCCA ...
-
bioRxiv - Biochemistry 2021Quote: ... Bio-Scale Mini Bio-Gel P-6 desalting cartridge was obtained from Bio-Rad (Hercules, CA). All UV-Vis measurements were taken using Cary 100 Bio UV-Vis from Agilent (Santa Clara ...
-
bioRxiv - Molecular Biology 2021Quote: ... PCR products were separated on nondenaturated 6% polyacrylamide gels and imaged by ChemiDoc system (Bio-Rad).
-
bioRxiv - Physiology 2021Quote: ... Relative protein abundance (N=6-8) were quantified using the Image Lab software (version 6.0.1; BioRad) and normalized by the protein content in each lane.
-
bioRxiv - Biophysics 2021Quote: ... AM2 was exchanged into each of these detergent solutions using Bio-Spin 6 columns (Bio-Rad) and diluted to a final concentration of 50 µM (per monomer ...
-
bioRxiv - Biophysics 2023Quote: ... Viroporins were exchanged into each of these ammonium acetate solutions using BioSpin 6 columns (Bio-Rad) and diluted to a final protein concentration of 20 μM (per monomer ...
-
bioRxiv - Biophysics 2023Quote: ... The Superose 6 column (24 mL bed volume) was calibrated using a commercial calibration kit (Biorad) containing thyroglobulin (670 kDa) ...
-
bioRxiv - Neuroscience 2024Quote: ... 1/6 of the total amount was loaded on a 4-20% SDS-PAGE (Bio-Rad), while the remaining sample was used for detecting NMNAT2 ...