Labshake search
Citations for Bio-Rad :
201 - 250 of 5252 citations for 6 Hydroxymethyl 4 methoxy 5 methyl nicotinic acid methyl ester since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2024Quote: ... 30μg total protein from tissue samples with 4X Laemmli buffer was heat denatured at 99°C for 5 minutes and ran on resolving SDS PAGE gel (Biorad 4-20% precast gel #4561096). Sperm protein samples were prepared using a low volume of lysis buffer (∼100) ...
-
bioRxiv - Biophysics 2024Quote: ... 5% acrylamide (BIORAD), 0.1% SDS ...
-
bioRxiv - Neuroscience 2021Quote: ... Samples were clarified by a brief centrifugation (10,000 g for 5 min at 4°C) and the supernatants were collected and diluted with 2× reducing Laemmeli buffer (Bio-Rad, Hercules, CA, USA, cat. #1610737). For preparation of cell culture lysates ...
-
bioRxiv - Biochemistry 2021Quote: ... Beads were incubated 5 min at 95 °C in this solution and 20 µL of supernatant was analyzed on gradient gels (BioRad 4-12% TGX pre-cast gels). The modified proteins were detected with an infrared imager (Odyssey ...
-
A tyrosine kinase protein interaction map reveals targetable EGFR network oncogenesis in lung cancerbioRxiv - Cancer Biology 2020Quote: ... 4 μl of the eluate was analyzed by 4-20% SDS PAGE (Biorad) and silver staining ...
-
bioRxiv - Plant Biology 2024Quote: ... 4× Laemmli buffer and 4-20% SDS-PAGE gels were purchased from BioRad.
-
bioRxiv - Cell Biology 2020Quote: Protein bands intensities were quantified with Image Lab 6 (BioRad). Equal rectangles were drawn around the total protein gel lane and the band of interest ...
-
bioRxiv - Developmental Biology 2021Quote: ... 6 μL of Sybr Green Super Mix 2X (Bio-Rad), 2,6 μl MQ H2O.
-
bioRxiv - Molecular Biology 2020Quote: ... resolving gels between 6% and 15% acrylamide/bis-acrylamide (BioRad) were used ...
-
bioRxiv - Immunology 2023Quote: ... Unreacted linker was separated with Bio-Spin 6 columns (BioRad), that were previously equilibrated in PBS ...
-
bioRxiv - Biochemistry 2023Quote: ... the samples were desalted using Biospin 6 columns (BioRad, CA), equilibrated with 50 mM triethylammonium bicarbonate and 0.02%(w/v ...
-
bioRxiv - Biochemistry 2022Quote: ... then desalted with Micro Bio-Spin 6 columns (Bio-Rad). To 22.5 μL of the resulting solutions was added KCl (final concentration 100 mM ...
-
bioRxiv - Biochemistry 2024Quote: ... The Bio-Spin 6 desalting column was obtained from BioRad. All T7 phage proteins and E ...
-
bioRxiv - Bioengineering 2024Quote: ... and interleukin 4 (IL-4)) cytokines run on a Bio-Plex 200 reader (BioRad). Data was collected from only two donors for RANTES ...
-
bioRxiv - Plant Biology 2021Quote: ... the gel was rinsed with acetic acid/methanol (Destain, Bio-Rad). Each lane was cut into 4 bands ...
-
bioRxiv - Microbiology 2020Quote: ... 10% acetic acid v/v and brilliant Coomassie blue (BioRad G250). For Western blotting ...
-
bioRxiv - Microbiology 2023Quote: ... Protein concentration was determined by the bicinchoninic acid assay (Bio-Rad), and the purified proteins were stored at −80°C until used.
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... 10% glacial acetic acid and imaged on a GelDoc (Bio-Rad).
-
bioRxiv - Molecular Biology 2021Quote: ... 4–20% gel (Bio-Rad) using SDS-PAGE ...
-
bioRxiv - Cell Biology 2020Quote: ... 0.8 × 4 cm (Bio-Rad). The column was washed with 10 column volumes (c.v. ...
-
bioRxiv - Cell Biology 2020Quote: ... 4-20% TGX gels (BioRad) were used ...
-
bioRxiv - Cell Biology 2021Quote: ... 4-20% gradient (Bio-Rad,); and then proteins were transferred to PVDF membranes ...
-
bioRxiv - Developmental Biology 2023Quote: ... 4-15% (Bio-Rad #4561085), with 1X Tris/Glycine/SDS Buffer (Bio-Rad #1610732) ...
-
bioRxiv - Cancer Biology 2024Quote: ... 4-12% acrylamide gels (BioRad) were loaded with protein samples ...
-
bioRxiv - Plant Biology 2021Quote: ... thaliana (5’-CAGGCGGTGGAAACTACCAAG-3’ and 5’-TACAGCACTGCACGGGTCGAT-3’) and R129_E (5’-CGAGCTAATCTCCAAAAGCCATC-3’ and 5’-TGACCCTACCGTGGTTAGCTG-3’) with iQ SYBR Green Supermix (BIO-RAD), as described previously (Garrido-Oter et al. ...
-
bioRxiv - Genetics 2022Quote: ... reverse 5’ - CACGTGGGACCGCTCGTCTCC) and MUC3B-specific primers (forward 5’ CGGGGGCCAGTGGGATGGCCTCAAG-3’; reverse 5’-CACGCGGGACCGCTCGTCTCT-3’) using SsoFast EvaGreen Supermix (#1725200, Bio-Rad) on a CFX96 Real-Time PCR Detection System (Bio-Rad ...
-
bioRxiv - Cancer Biology 2020Quote: ... Lysates were run on 4–15% or 4-20% Mini-protean TGX gels (Bio-Rad) and transferred onto ImmobilonTM membranes (MilliporeSigma ...
-
bioRxiv - Systems Biology 2021Quote: ... Immunoprecipitated proteins (4 μl) were resolved on 4-20% Criterion Tris-HCl Precast gels (BioRad) and visualized by silver stain (Pierce Silver Stain Kit ...
-
bioRxiv - Microbiology 2024Quote: ... using precast 4-20 % polyacrylamide gels (4-20 % CriterionTM TGX BioRadTM, BIO-RAD, Hercules, USA).
-
bioRxiv - Molecular Biology 2021Quote: ... the samples were incubated with 6× Laemmle Sample Buffer (Bio-Rad) with 10% β-mercaptoethanol and boiled for 5 min at 100°C ...
-
bioRxiv - Physiology 2020Quote: ... followed by RNA purification with Micro Bio-spin 6 columns (BioRad).
-
bioRxiv - Microbiology 2021Quote: ... and then run through Bio-Spin 6 columns (Bio-Rad #7326002) twice ...
-
bioRxiv - Plant Biology 2022Quote: ... Protein band intensities were quantified via Image Lab 6 (Bio-Rad) as previously described in Stephani and Picchianti et al. ...
-
Structure of the Human Signal Peptidase Complex Reveals the Determinants for Signal Peptide CleavagebioRxiv - Biochemistry 2020Quote: ... by using gel filtration with P-6 Bio-Spin columns (BioRad). The resulting protein concentration was estimated to be ∼1-2 µM before native MS analysis.
-
bioRxiv - Molecular Biology 2022Quote: ... Following clean up with Micro Bio-Spin 6 columns (Bio-Rad), the 3’-end-labeled RNA was incubated with RNase A (Thermo Scientific(tm) ...
-
bioRxiv - Cell Biology 2021Quote: ... Membranes were blocked in 5% BSA or 5% milk dissolved in TBS (Biorad) containing 0.1% Tween 20 (Sigma ...
-
bioRxiv - Immunology 2023Quote: ... and finally TMB (3,3’, 5, 5’-tetramethylbenzidine) Core+ reagent (Bio-Rad cat # BUF062C) for development ...
-
bioRxiv - Microbiology 2021Quote: ... Protein concentrations were determined with the bicinchoninic acid (BCA) protein kit (BioRAD).
-
bioRxiv - Plant Biology 2023Quote: ... and agarose gel in tris/acetic acid/EDTA (Bio-rad, California, USA) were used for different stiffness ...
-
bioRxiv - Molecular Biology 2022Quote: ... nucleic acid stain were imaged with ChemiDoc XRS+ Gel Imaging System (BIORAD). The 1 Kb Plus DNA Ladder (Invitrogen ...
-
bioRxiv - Molecular Biology 2024Quote: ... Bones were then decalcified by rocking in 19 % ethylenediaminetetraacetic acid (Biorad, 1610729) for 14 days at 4 °C with solution changes every other day ...
-
bioRxiv - Bioengineering 2024Quote: ... equipped with Aminex Fast Acid Analysis and HPX-87H columns (Bio-Rad) at 55°C and 2 mM H2SO4 as the eluent at a flow rate of 0.5 ml min-1 ...
-
bioRxiv - Biophysics 2021Quote: ... the mix contained 4% acrylamide (BioRad), 0.03% BisAcrylamide (BioRad) ...
-
bioRxiv - Cell Biology 2020Quote: ... precast 4-18% gradient gels (BioRad). Recombinant N-terminally acetylated α- ...
-
bioRxiv - Cell Biology 2022Quote: ... 4%-20% gradient gels (Bio-Rad) were used for Sml1 blots and 4%-15% gradient gels (Bio-Rad ...
-
bioRxiv - Biochemistry 2021Quote: ... 4× Laemmli Sample Buffer (Bio-Rad) was added and samples were run in SDS-PAGE without extra elution steps ...
-
bioRxiv - Biochemistry 2020Quote: ... 4–20% gradient gels (Bio-Rad), and protein bands were visualized with Coomassie Brilliant Blue (Bio-Rad ...
-
bioRxiv - Genetics 2021Quote: ... 4% goat/donkey serum (Bio-Rad Laboratories ...
-
bioRxiv - Molecular Biology 2024Quote: ... at 4°C (Bioruptor Pico, BioRad). Then ...
-
bioRxiv - Cancer Biology 2023Quote: 4–20% polyacrylamide gels (Bio-Rad) were used for protein separation ...