Labshake search
Citations for Bio-Rad :
201 - 250 of 7370 citations for 1 Benzyl 3 Tert Butyldimethylsilyl Oxy Methyl Piperidin 4 One since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2021Quote: ... The iTaq Universal SYBR Green One-Step Kit (Bio-Rad) was used to run the RT-qPCR reactions ...
-
bioRxiv - Animal Behavior and Cognition 2021Quote: ... and quantified by The Quantity One software v4.6.3 (Bio-Rad). Optical density values for target proteins were normalized to Ponceau staining of the nitrocellulose membrane as loading control ...
-
bioRxiv - Immunology 2021Quote: ... using the iTaq Universal Probes One-Step RTqPCR kit (BioRad) with N2 primers and probes targeting the nucleocapsid (36) ...
-
bioRxiv - Molecular Biology 2021Quote: ... The signals were quantified using Quantity One software (Bio-Rad), and normalized to the last sample (set as 1) ...
-
bioRxiv - Immunology 2021Quote: ... using the iTaq Universal Probes One-Step RTqPCR kit (BioRad) with N2 primers and probes targeting the nucleocapsid 41 ...
-
bioRxiv - Molecular Biology 2022Quote: ... or a QX ONE Droplet Digital PCR System (Bio-Rad) following the manufacturer’s recommendations ...
-
bioRxiv - Cell Biology 2023Quote: ... Band intensity was measured using Quantity One software (Bio-Rad). Quantitative ratios were calculated based on the data and are presented as relative values.
-
bioRxiv - Microbiology 2023Quote: ... The gel was activated using one-minute setting (Bio-Rad Imager ...
-
bioRxiv - Bioengineering 2022Quote: iTaq Universal Probes One-Step Kit (Biorad, cat. no. 1725141)
-
bioRxiv - Developmental Biology 2022Quote: ... Expression was evaluated by Quantity One® (v4.6.7, Bio-Rad) densitometry to adjust for equal amounts of expression using WCL of untransfected cells to maintain total protein content ...
-
bioRxiv - Immunology 2022Quote: ... the iTaq Universal Sybr green One-step kit (Bio-Rad) was used ...
-
bioRxiv - Physiology 2024Quote: ... Band densitometry was carried out using Quantity One (Bio-Rad). Primary antibodies used are specified in Supplementary table 2.
-
bioRxiv - Neuroscience 2024Quote: ... controlled by The Quantity One software v 4.6.9 (Bio-Rad). For quantitative purposes ...
-
bioRxiv - Molecular Biology 2024Quote: ... system using iTaq Universal SYBR Green One-Step Kit (Biorad). 150 ng of total RNA was loaded ...
-
bioRxiv - Molecular Biology 2024Quote: ... One part was directly mixed with Laemmli buffer (Bio-Rad) containing 100 mM DTT and boiled for 5 min ...
-
bioRxiv - Neuroscience 2024Quote: ... using for imaging one ChemiDocTM Touch Imaging System (BioRad, 1708370). To check the global biotinylation reaction ...
-
bioRxiv - Microbiology 2024Quote: ... using iTaq universal Probes One-step RT-qPCR kit (BioRad) with N2 primers and probes (IDT ...
-
bioRxiv - Microbiology 2024Quote: ... and iTaq Universal SYBR Green One-Step kit (Bio-Rad). Primers for RT-qPCR are described in Table 3.
-
bioRxiv - Plant Biology 2021Quote: ... thaliana (5’-CAGGCGGTGGAAACTACCAAG-3’ and 5’-TACAGCACTGCACGGGTCGAT-3’) and R129_E (5’-CGAGCTAATCTCCAAAAGCCATC-3’ and 5’-TGACCCTACCGTGGTTAGCTG-3’) with iQ SYBR Green Supermix (BIO-RAD), as described previously (Garrido-Oter et al. ...
-
bioRxiv - Immunology 2023Quote: ... 5’ GACGTGGGCTCCTTACACTGA 3’)(41) and 18s (Fwd: 5’ CTTAGAGGGACAAGTGGCG 3’, Rev: 5’ ACGCTGAGCCAGTCAGTGTA 3’)(42) using the SsoFast assay system (BioRad) was used to quantify transcripts in a BioRad CFX94 machine.
-
bioRxiv - Immunology 2023Quote: ... Primary antibody staining was performed overnight at 4&C using rabbit anti-mouse Iba-1 (1:500; Wako Chemical Cat #019-19741) and CD68 (1:200; Bio-Rad Cat #MCA1957) with secondary staining performed for 45 minutes RT using Alexa Flour 594 donkey anti-rabbit (1:400 ...
-
bioRxiv - Microbiology 2021Quote: ... Gels were stained with ethidium bromide (0.5 mg mL-1) and photographed using the Quantity One electrophoresis analysis system (Bio-Rad, CA, USA). Gel images were digitally normalized to a single DNA marker to reduce gel-to-gel banding pattern variability ...
-
bioRxiv - Molecular Biology 2021Quote: ... Protein samples were mixed 1:4 with 4X Laemmli buffer (Bio-Rad, Lunteren, Netherlands) containing 10% (v/v ...
-
bioRxiv - Genomics 2024Quote: ... and counted (1:4 dilution) with TC20 Automated Cell Counter (Bio-rad cat. #1450102). Cells were fixed using Parse Biosciences’ Nuclei Fixation Kit v1 (Parse Biosciences cat ...
-
bioRxiv - Cell Biology 2023Quote: ... for 1 h at 4°C using the Mini Trans-Blot Cell (Bio-Rad). After the transfer ...
-
bioRxiv - Cell Biology 2024Quote: ... for 1 h at 4°C using the Mini Trans-Blot Cell (Bio-Rad). After the transfer ...
-
bioRxiv - Cell Biology 2024Quote: ... for 1 h at 4°C using the Mini Trans-Blot Cell (Bio-Rad). After the transfer ...
-
bioRxiv - Bioengineering 2023Quote: ... This step was repeated for 3 times and the samples were concentration-matched at OD500nm = 10 and mixed 1:1 with 2x Laemmli buffer (Bio-Rad), containing SDS and 2-mercaptoethanol ...
-
bioRxiv - Cell Biology 2021Quote: ... 2-3 μg of total protein were loaded onto 10% SDS-polyacrylamide (29:1 Bio-Rad) gels with 10 μM phostag reagent (FUJIFILM Wako Chemicals ...
-
bioRxiv - Molecular Biology 2020Quote: ... Normalised samples (1 – 3 µg) were electrophoresed on 12% Mini-Protean TGX Stain-Free gels (BioRad) or 4-20% Criterion TGX Stain-Free Precast gels (BioRad ...
-
bioRxiv - Microbiology 2024Quote: ... 10% glycerol) then boiled with 1/3 volume of 4x Laemmli sample buffer (Bio-Rad, 1610747) for 10 mins ...
-
bioRxiv - Biochemistry 2023Quote: ... expression media samples were diluted with 2X reducing SDS sample buffer at 1:1 ratio and the mixture was loaded on a 10-well 4–20% SDS-PAGE gradient gel (BioRad). Image J software was used to quantify the signal compared to the negative control (mock transfected culture) ...
-
bioRxiv - Cell Biology 2020Quote: ... and films were scanned and analysed using Quantity One (Bio-Rad).
-
bioRxiv - Molecular Biology 2021Quote: ... iTaq Universal SYBR Green One-step kit (Bio-Rad, Hercules, CA) with DENV-2 specific primers and following a standard protocol (S1 Table ...
-
bioRxiv - Neuroscience 2020Quote: ... Densitometry analysis was performed using the Quantity One software (Bio-Rad).
-
bioRxiv - Bioengineering 2020Quote: ... both using the iTaq universal SYBR green one-step kit (BioRad). For 1-step RT-qPCR ...
-
bioRxiv - Bioengineering 2020Quote: ... and the data were analyzed using Quantity One (Bio-Rad, USA).
-
bioRxiv - Bioengineering 2020Quote: ... and the data were analyzed using Quantity One (Bio-Rad, USA).
-
bioRxiv - Molecular Biology 2020Quote: ... and were imaged using Quantity One Version 4.6 software (BioRad, U.K.).
-
bioRxiv - Molecular Biology 2022Quote: ... in combination with Quantity One software (Version 4.6.3. Bio-Rad Laboratories). Based on both total protein measurement and WB images of APOA1 ...
-
bioRxiv - Immunology 2022Quote: ... using the iTaq Universal Probes One-Step RT-qPCR kit (BioRad) with N2 primers and probes targeting the nucleocapsid (72) ...
-
bioRxiv - Cell Biology 2020Quote: ... iTaq Universal SYBR Green One Step Kit (Bio-Rad, Cat#1725150) was used to carry out one-step qRT-PCR and reactions were performed using 300ng of RNA ...
-
bioRxiv - Microbiology 2020Quote: ... the One-Step RT-ddPCR Advanced Kit for Probes (Bio-Rad) was applied according to the supplier’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... using the iTaq Universal Probes One-Step RT-qPCR kit (BioRad) with primers and probes (Table S1 ...
-
bioRxiv - Microbiology 2020Quote: ... using the iTaq Universal Probes One-Step RT-qPCR kit (BioRad) with N2 primers and probes targeting the nucleocapsid16 ...
-
bioRxiv - Cell Biology 2021Quote: ... MMP2/9 secretion was quantified using Quantity One Software (Bio-Rad).
-
bioRxiv - Microbiology 2020Quote: ... Blots were analyzed using Quantity One software (Bio-Rad, California, USA).
-
bioRxiv - Microbiology 2021Quote: ... using the iTaq Universal Probes One-Step RT-qPCR kit (BioRad) with N2 primers and probes targeting the nucleocapsid59 ...
-
bioRxiv - Plant Biology 2020Quote: ... and radioactivity counts were analyzed using Quantity One software (Bio-Rad). Statistical analysis was performed using GraphPad Prism software.
-
bioRxiv - Cell Biology 2020Quote: ... One-Step RT-ddPCR Advanced Kit for Probes (Bio-Rad Laboratories), and probes were prepared on a QX200 Droplet Generator (Bio-Rad Laboratories) ...