Labshake search
Citations for Bio-Rad :
2401 - 2450 of 4225 citations for Rat Alpha ketoglutarate dependent dioxygenase FTO FTO ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2019Quote: ... Complimentary DNA (cDNA) were prepared by following manufacturer’s instruction (iScript select cDNA synthesis kit, Bio-Rad). Validated primers were obtained from AtRTPrimer database (Han and Kim 2006) ...
-
bioRxiv - Biochemistry 2019Quote: ... Reverse transcription assay was performed by using the iScript cDNA Synthesis Kit (BioRad, Hercules, CA, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Systems Biology 2019Quote: ... Proteins were quantified in the supernatants using the RC DC™ protein assay kit (Bio-Rad), according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2019Quote: ... Total RNA was collected in 14μl and was reverse transcribed using the iScript kit (Bio-Rad). Real time was performed in an iQ5 cycler (Bio-Rad ...
-
bioRxiv - Immunology 2019Quote: ... Total RNA was extracted using Aurum™ Total RNA Fatty and Fibrous Tissue Kit (Bio-Rad) according to the manufactures’s instructions ...
-
bioRxiv - Neuroscience 2019Quote: ... and cDNA was made by using the iScript cDNA synthesis kit (Bio-Rad, Hercules, CA, USA). Finally ...
-
bioRxiv - Cell Biology 2019Quote: ... cDNA was synthesized from 1 µg RNA by using the iScript cDNA synthesis kit (Bio-Rad). Quantitative PCR (qPCR ...
-
bioRxiv - Biochemistry 2020Quote: ... and cDNA obtained using the reverse transcription iScript™ supermix kit (Bio-Rad, Hercules, CA, USA). Real-time RT quantitative PCR reactions were performed in a CFX96™ Real-Time System (Bio-Rad ...
-
bioRxiv - Genetics 2020Quote: ... 1μg of total liver mRNA was reverse transcribed using the iScript kit (Bio-Rad, Hercules, CA). Aliquots of cDNA were amplified in triplicate using TaqMan master mix (Applied Biosystems ...
-
bioRxiv - Cell Biology 2020Quote: ... cDNA was then synthesized from 500ng of RNA using the iScript cDNA Synthesis Kit (Bio-Rad), along with “no reverse transcriptase” and “no RNA” negative controls ...
-
bioRxiv - Bioengineering 2020Quote: ... and cDNA was prepared using 500 ng sample RNA templates using iScript cDNA Synthesis Kit (BioRad). RT-qPCR analysis was performed on a CFX96 real-time PCR detection system (BioRad ...
-
bioRxiv - Biochemistry 2021Quote: ... Protein concentrations were determined using a Bradford protein assay kit (Quick Start™, Bio-Rad, USA).
-
bioRxiv - Biochemistry 2021Quote: ... Proteins were quantified in the supernatants using the RC DC™ protein assay kit (Bio-Rad), according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2020Quote: ... The cDNA synthesis kit and iQ SYBR Green Supermix were from Bio-Rad (Hercules, CA, USA).
-
bioRxiv - Neuroscience 2021Quote: ... the protein concentration was determined using a Bio-Rad DC™ protein assay kit (Bio-Rad). Proteins (15 µg ...
-
bioRxiv - Physiology 2020Quote: ... cDNA was synthesized by reverse transcription from mRNA using the iScript cDNA Synthesis Kit (Bio-Rad). Gene expression was performed by quantitative real time RT-PCR using Taqman gene expression assay was performed using StepOnePlus detection system (Applied Biosystems ...
-
bioRxiv - Microbiology 2021Quote: ... Protein bands were visualized using SuperSignal West Pico Chemiluminescent Substrate kits (Bio-Rad, Hercules, CA, USA) and quantified by densitometry using ImageJ software (NCBI ...
-
bioRxiv - Cancer Biology 2020Quote: ... Messenger RNA was converted to the first-strand cDNA using iScript cDNA synthesis kit (Bio-Rad), followed by RT-PCR reaction using SYBR Green PCR Master Kit in QuantStudio 5 Systems (Applied Biosystems) ...
-
bioRxiv - Cancer Biology 2020Quote: ... and reverse transcribed into cDNA with iScript™ cDNA Synthesis Kit (BioRad, Hercules, CA, Cat#: 1708891) as stated in the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2020Quote: ... The protein content of the exosomes was measured using a BCA protein assay kit (Bio-Rad). Exosomes were aliquoted and stored at −80°C for further usage.
-
bioRxiv - Cancer Biology 2020Quote: ... 1 µg of RNA was reverse transcribed to cDNA by iScript cDNA synthesis kit (BioRad #17088) as per the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... Protein concentrations for both soluble and pellet fractions were determined by DC protein assay kit (Biorad).
-
bioRxiv - Biochemistry 2021Quote: ... RT-PCR were performed by using Hieff™ qPCR kits (Yeasen, Shanghai, China) on CFX96 (Biorad) according to the manufacturer’s instruction ...
-
bioRxiv - Plant Biology 2021Quote: ... Protein concentrations were determined using the RC DC Protein Assay kit (Bio-Rad, cat. no. 5000122). Quality of protein samples were verified by loading equal protein amounts into an SDS-PAGE gel before capillary immunoblotting ...
-
bioRxiv - Plant Biology 2020Quote: ... was used to remove DNA contaminations and the iScript TM cDNA synthesis kit (Bio-Rad Laboratories) was used for RNA reverse-transcription.
-
bioRxiv - Microbiology 2020Quote: ... Protein bands were visualized using SuperSignal West Pico Chemiluminescent Substrate kits (Bio-Rad, Hercules, CA, USA) and quantified by densitometry using ImageJ software (NCBI ...
-
bioRxiv - Microbiology 2020Quote: ... The membranes were visualized using the chemiluminescence detection kit Clarity ECL Western Blotting Substrates (Bio-Rad) in an Alliance Q9 Advanced machine (Uvitec).
-
bioRxiv - Plant Biology 2020Quote: ... cDNA was synthesized by reverse-transcription using an iScript™ cDNA Synthesis Kit (Bio-Rad; www.biorad.com). Quantitative Real-Time PCR was performed using a SensiFAST™ SYBR® No-ROX Kit (Bioline ...
-
bioRxiv - Microbiology 2020Quote: ... The qRT-PCR assay was done using the iTaq kit according to the manufacturer’s instructions (BioRad). Oligos for the qRT-PCR reactions are shown in table 2 ...
-
bioRxiv - Plant Biology 2021Quote: ... cDNA was synthesized from 750ng RNA using the iScript cDNA Synthesis Kit (Bio-Rad: 170-8890) according to the manufacturer’s protocol ...
-
bioRxiv - Plant Biology 2021Quote: ... 500ng of RNA was used for cDNA synthesis with iScript cDNA synthesis kit (Bio-rad, 1708890). Transcripts of spx1 (F- TGCCGCCTCTACAGTTAAATGGC ...
-
bioRxiv - Plant Biology 2021Quote: ... cDNA was synthesized from 1 μg total RNA using iScript cDNA synthesis kit (1706691, Bio-Rad). Transcript levels were analysed from three biological replicates by real time quantitative PCR (qRT-PCR) ...
-
bioRxiv - Genetics 2021Quote: ... Genotyping was performed by ddPCR using the ddPCR Supermix for Probes (No dUTP) kit (Bio-Rad) and the following primer and probe sets ...
-
bioRxiv - Genomics 2019Quote: ... and 500 ng of total RNA was reverse-transcribed using iScript cDNA synthesis kit (Bio-Rad). qRT-PCR quantification of HIPK-1 ...
-
bioRxiv - Microbiology 2021Quote: ... Mixes were prepared according to the manufacturer’s instructions (iTaq Universal SYBR green One-Step kit, BioRad) with 1µL of RNA and a final concentration of 0.3µM of each primer.
-
bioRxiv - Microbiology 2021Quote: ... and used directly for quantitative PCR (qPCR) analysis with the SYBR green qPCR kit (Bio-Rad).
-
bioRxiv - Microbiology 2021Quote: ... and used directly for quantitative PCR (qPCR) analysis with the SYBR green qPCR kit (Bio-Rad). Signals obtained by qPCR were normalized to those for 18S unless otherwise noted.
-
bioRxiv - Microbiology 2021Quote: ... RNA (1 μg) was reverse transcribed using an iScript gDNA Clear cDNA synthesis kit (Bio-Rad). Quantitative PCR was performed with SYBR green (SsoAdvanced ...
-
bioRxiv - Microbiology 2021Quote: ... cDNA was reverse transcribed from RNA samples using the iScript cDNA Synthesis Kit (Biorad, Hercules, CA) according to the recommended reaction protocol on the ProFlex PCR System (Applied Biosystems ...
-
bioRxiv - Microbiology 2021Quote: ... 2.5 ul of RNA was amplified using the iTaq Universal SYBR Green One Step kit (Biorad) and the following primers (SD29629:AGAAAACGCCGGTAGCAGAA and SD30197:CCTTCCCGAGCCTTCAACAT ...
-
bioRxiv - Molecular Biology 2021Quote: ... cDNA was synthesised from 2 µg purified RNA using iScript™ cDNA Synthesis Kit (Bio-Rad) and quantified by qRT-PCR using iTaq™ Universal SYBR® Green Supermix ...
-
bioRxiv - Cell Biology 2021Quote: ... Protein concentration in lysates in urea buffer was quantified with a Bradford Protein assay kit (Biorad) and lysates in RIPA buffer with BCA protein assay kit (Pierce) ...
-
bioRxiv - Cell Biology 2021Quote: ... Protein concentrations were measured using the DCTM Protein Assay Kit I from Bio-Rad (cat # 5000111) by following the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2020Quote: ... 500 ng RNA was used for cDNA synthesis using the iScript cDNA Synthesis Kit (BIO-RAD) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: ... The supernatant was collected and estimated for protein concentration using DC protein assay kit (Bio-Rad). For immunoblotting ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Protein concentration in the supernatant was measured using DC™ Protein assay kit (BIO-RAD, UK) according to manufacturer’s specifications using bovine serum albumin (BSA ...
-
bioRxiv - Cancer Biology 2021Quote: ... The cDNA was generated from the RNA samples using an iScript kit (BioRad, Hercules, CA, USA) per manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2021Quote: ... scATAC-Seq libraries were prepared using the SureCell ATAC-Seq Library Prep Kit (17004620, Bio-Rad) and SureCell ATAC-Seq Index Kit (12009360 ...
-
bioRxiv - Cell Biology 2022Quote: ... Quantitative PCR was performed using the iScript one step RT-PCR SYBR green kit (Bio-Rad). RT-qPCR was performed in duplicate for each of three independent biological replicates ...
-
bioRxiv - Synthetic Biology 2022Quote: The qRT-PCR reaction was conducted using the iTaq Universeral Probes one-step kit (Bio-Rad) supplemented with SybrGreen I nucleic acid stain (Invitrogen) ...