Labshake search
Citations for Bio-Rad :
2251 - 2300 of 10000+ citations for Human Chemokine C X C Motif Receptor 5 CXCR5 Protein since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: ... combined with a 4.6 x 30 mm Cation H guard column (Biorad). Elution of was performed with a constant flow rate of 0.6 mL min-1 and a mobile phase of 5 mM H2SO4 ...
-
bioRxiv - Biochemistry 2020Quote: ... and permeabilized for one hour with 0.1% Triton X-100 (Biorad 1610407) supplemented with 1% BSA (Sigma) ...
-
bioRxiv - Molecular Biology 2021Quote: ... The qPCR was performed with 1 x iTaq SYBR Green Supermix (Biorad), 0.4 µM of each primer and 1 µl of the cDNA sample ...
-
bioRxiv - Immunology 2022Quote: ... samples were mixed 1:1 with 2 x native sample buffer (BioRad) and loaded on a 4-20% precast protein gel (BioRad ...
-
bioRxiv - Neuroscience 2022Quote: ... permeabilized for 10 min with 0.5% Triton X-100 (Bio-Rad, USA) in phosphate buffered saline (PBS) ...
-
bioRxiv - Developmental Biology 2024Quote: ... and exposed to X-ray film or a ChemiDoc imaging system (BioRad).
-
bioRxiv - Molecular Biology 2024Quote: ... To the washed beads 40 µL of 2 X Laemmli buffer (BioRad) was added and incubated for 10 min at +50 °C ...
-
bioRxiv - Molecular Biology 2023Quote: ... Electroporation was performed using the Gene Pulser X cell electroporation system (Biorad) set at 2500 V ...
-
bioRxiv - Immunology 2023Quote: ... The 450nm absorbance was measured on the X Mark microplate spectrophotometer (Biorad). C11 (564Igi antibody derived from a hybridoma ...
-
bioRxiv - Biochemistry 2024Quote: ... the PVDF membrane (Immuno-Blot Bio-Rad 1620177, 26cm x 3.3m, 0.2um) was soaked in 100% methanol for 30-60 min ...
-
bioRxiv - Cancer Biology 2021Quote: ... 5 µL of SybrGreen (BioRad) and 2.5 µL of primer-mix (800 nM ...
-
bioRxiv - Microbiology 2019Quote: ... 5 µl HF buffer (BioRad), 5 µl combinational enhancer solution (2.7 M betaine ...
-
bioRxiv - Cell Biology 2020Quote: ... Precision Plus Protein Standards (BioRad) were used in every gel as molecular weight standards ...
-
bioRxiv - Cell Biology 2022Quote: ... using Protein Assay Dye (BioRad). 20 μg protein from each sample was separated on 6% or 8% gels by SDS-PAGE and subsequently transferred to a nitrocellulose membrane ...
-
bioRxiv - Microbiology 2020Quote: ... Protein quantification by Bio-Rad protein assay was carried out on the same lysates to normalize the B-gal data for protein content.
-
bioRxiv - Neuroscience 2021Quote: ... detergent compatible protein assays (Biorad) were carried out in duplicates ...
-
bioRxiv - Cancer Biology 2020Quote: ... DC protein assay (Bio-Rad) was used to quantify the protein concentration ...
-
bioRxiv - Biochemistry 2022Quote: ... Precision Plus Protein Standard (BioRad) was run as molecular weight marker ...
-
bioRxiv - Microbiology 2022Quote: ... Bradford protein assay (Bio-Rad) was used to determine protein concentration ...
-
bioRxiv - Physiology 2020Quote: ... A Biorad protein assay (Biorad) was used to quantify the protein and Coomassie protein stain (InstantBlue™ Protein Stain Instant Blue ...
-
bioRxiv - Molecular Biology 2020Quote: ... The Bradford protein assay (BioRad) was used to compare protein concentrations across samples.
-
bioRxiv - Genetics 2021Quote: ... Bradford protein assay (Bio-Rad) was employed to quantify proteins ...
-
bioRxiv - Microbiology 2021Quote: ... Precision Plus Protein Kaleidoscope (BioRad) was used as a molecular weight standard ...
-
bioRxiv - Cancer Biology 2020Quote: ... Protein concentrations were measured by Bio-Rad protein assay (#5000006, Bio-Rad) and equal volume and quantity of protein samples were made by addition of 4x Laemmli Sample Buffer (#1610747 ...
-
bioRxiv - Molecular Biology 2020Quote: ... A protein transfer apparatus (BioRad) was used for transferring proteins to a Sequi-Blot PVDF membrane (BioRad ...
-
bioRxiv - Microbiology 2021Quote: ... Protein standards from Bio-Rad were used to interprete elution profiles ...
-
bioRxiv - Cell Biology 2021Quote: ... Cholesterol concentrations were normalized by the protein concentration determined by Bio-Rad Protein Assay Dye (Bio-Rad).
-
bioRxiv - Cell Biology 2024Quote: ... REVERT total protein stain (BioRad) was used as indicated by manufacturer.
-
bioRxiv - Molecular Biology 2023Quote: ... and Protein Kaleidoscope (BioRad 1610375) was used as a molecular weight marker ...
-
bioRxiv - Molecular Biology 2023Quote: ... BCA Protein Assay (Bio-Rad) was used to normalize the results to protein levels.
-
bioRxiv - Neuroscience 2023Quote: ... DC protein assay (Bio-Rad) was used to quantify protein ...
-
bioRxiv - Cell Biology 2023Quote: ... cleared supernatant was transferred to the new clean Eppendorf tubes and total protein concentration was measured using Bradford assay by Bio-Rad Protein Assay kit (Bio-Rad). Nuclear and cytoplasmic proteins were prepared using the NE-PER nuclear and cytoplasmic extraction reagent kit (Thermo Scientific™ ...
-
bioRxiv - Biochemistry 2023Quote: ... The Precision Plus Protein (Biorad) was used as a molecular weight ladder.
-
bioRxiv - Biochemistry 2023Quote: ... standard globular proteins (Bio-Rad), PrPC and recPrP ...
-
bioRxiv - Biophysics 2022Quote: ... SEC protein standards (BioRad; #1511901) were used to ensure Superose 6 column performance was adequate (Figure S4) ...
-
bioRxiv - Cell Biology 2023Quote: ... total protein concentration was measured using Bradford assay by Bio-Rad Protein Assay kit (Bio-Rad). Samples were boiled for 10 min at 96 °C in 1X Laemmli buffer (LB ...
-
bioRxiv - Cell Biology 2023Quote: ... Protein ladder (Biorad, catalog #: 1610395) was used to locate the molecular weight ...
-
bioRxiv - Molecular Biology 2023Quote: ... a protein mix (Bio-Rad size exclusion standard ...
-
bioRxiv - Biochemistry 2023Quote: ... protein electrophoresis equipment (Bio-Rad), ChemiDoc Touch Imaging system (Bio-Rad) ...
-
bioRxiv - Molecular Biology 2020Quote: ... goat anti-human IgG Fc (Biorad; 5211-8004; 1:2000) and rabbit anti-Vinculin (EPR8185 ...
-
bioRxiv - Microbiology 2021Quote: ... the Pro™ Human Cytokine 27-plex Assay (Bio-Rad) was used according to the manufacturer’s protocol and read on a Bio-Plex 3D suspension array system including a Bio-Plex Manager software v 6.0 (Bio-Rad).
-
bioRxiv - Developmental Biology 2022Quote: ... or anti-Human IgG Kappa (STAR 127, Bio-Rad, USA) control antibody
-
bioRxiv - Microbiology 2022Quote: ... and HRP-conjugated goat anti-human IgG (BioRad #172-1050) were used as secondary antibodies for ELISA and western blot assays.
-
bioRxiv - Immunology 2019Quote: ... or RasGRP1 (PrimePCR SYBR Green Assay RasGRP1 human, Bio-Rad, amplicon context sequence GGTTCCTTGGTTCCCGGGCATAGGAAAGCTCATAGATTTCATCCTCAGTGTAGTAAAGAT CCAGGGATAACGTCAGCAAGTGTACCAAGTCCTTGTTAGCCTCCAAGG (exon 10) ...
-
bioRxiv - Cancer Biology 2021Quote: ... Bio-Plex Pro Human Cytokine ICAM-1 (BioRad, USA; 171B6009M) and Bio-Plex Pro Human Cytokine VCAM-1 (BioRad ...
-
bioRxiv - Molecular Biology 2022Quote: ... goat anti-human IgG F(ab’)2 (STAR126, Bio-Rad), anti-M13-pVIII-HRP (Cytiva 27-9421-01 ...
-
bioRxiv - Immunology 2023Quote: ... goat anti-human– horseradish peroxidase (HRP) secondary antibody (Bio-Rad) at a 1:3,000 dilution was applied for 1 h at 4°C ...
-
bioRxiv - Synthetic Biology 2024Quote: ... Mouse monoclonal anti-Human Vinculin (V284) antibody (Bio-Rad, MCA465GA), 1:1,000 ...
-
bioRxiv - Cell Biology 2020Quote: Protein samples were run in Mini-PROTEAN® TGX 4-15% Precast protein gels (BioRad) and transferred to nitrocellulose membranes ...
-
bioRxiv - Cell Biology 2020Quote: ... 25 μg of protein / well and Precision Plus Protein All Blue Standards (Biorad #161-0373) were run on 4-20% polyacrylamide gels (Biorad #4561096 ...