Labshake search
Citations for Bio-Rad :
2251 - 2300 of 4034 citations for 7 3 Chloropropoxy 4 chloroquinazoline since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2021Quote: ... Scientific until approximately 3 cm of separation was obtained between the 25 and 37 kDa protein standards (Bio-Rad; 1610375). Using electrophoresis ...
-
bioRxiv - Molecular Biology 2020Quote: ... Each reaction contained 3 technical replicates and were carried out using a CFX384 TouchTM Real-Time PCR Detection System (BioRad Laboratories Ltd. ...
-
bioRxiv - Microbiology 2020Quote: ... Samples were run in 3-12% Bis-Tris gradient gels and transferred to PVDF membranes in a wet blot system (BioRad). Membranes were dried ...
-
bioRxiv - Microbiology 2020Quote: ... were mixed in a 1000:3 ratio and added to the blots prior to visualization via Chemidoc Touch Imaging system (BioRad). For OmpT visualization ...
-
bioRxiv - Cell Biology 2020Quote: ... were added for 4 h and then samples were centrifuged at 10,000g for 3 minutes and washed three times with RIPA buffer and re-suspended in laemmli buffer (Bio-Rad), boiled for 5 minutes ...
-
bioRxiv - Biophysics 2020Quote: ... before being transferred to Whatman 3 MM paper and dried (50°C, 2 hours) using a gel dryer (Model 583, BioRad) attached to a vacuum pump ...
-
bioRxiv - Microbiology 2022Quote: ... Intact cells were divided into 100-μl aliquots and heated individually at different temperatures for 3 minutes in a PCR machine (Biorad), followed by cooling for 2 minutes at room temperature ...
-
Proteolytic cleavage of the extracellular domain affects signaling of parathyroid hormone receptor 1bioRxiv - Pharmacology and Toxicology 2022Quote: ... Lysates were cleared by centrifugation and run on 10% SDS-polyacrylamide gels in a Mini-PROTEAN 3 cell apparatus (Biorad). Proteins were electroblotted onto Immobilon P membranes (Millipore ...
-
bioRxiv - Molecular Biology 2022Quote: ... Ten micrograms of total RNA were separated on a 1% agarose gel containing 1X 3-(N-morpholino)propanesulfonic acid (MOPS) buffer and 2.2 M formaldehyde and transferred to a Zeta-probe membrane (Bio-Rad) by capillary transfer in 20X SSC buffer (3 M NaCl ...
-
bioRxiv - Molecular Biology 2019Quote: ... Reactions were then mixed with 10 pmol of GRIA2 forward primer (5’ GGGATTTTTAATAGTCTCTGGTTTTCCTTGGG 3’) and reverse primer and 1X iTaq Universal SYBR Green Supermix (BioRad). qPCR was monitored with a Roche Lightcycler 96 instrument ...
-
bioRxiv - Biophysics 2019Quote: Proteins for native mass spectrometry were buffer exchanged into 50mM ammonium acetate by 3 rounds of gel filtration using BioGel P6 (Biorad) spin columns according to the manufacturer’s instructions ...
-
bioRxiv - Synthetic Biology 2019Quote: ... A total of 3 μg of protein was loaded to Mini-PROTEAN TGX Stain-Free Gels (10% gel, BIO-RAD). Proteins were transferred to standard PVDF membranes through an OWL semi-dry transfer apparatus ...
-
bioRxiv - Molecular Biology 2019Quote: ... Bound proteins were washed 3 times in 500 mM KCl and eluted on Bio-spin disposable chromatography columns (Bio-Rad) with flag peptide as described in (88) ...
-
bioRxiv - Developmental Biology 2020Quote: ... Western blots were performed either with Criterion ™ XT Tris-Acetate Precast Gels 3–8 % (3450130, Bio-Rad, Hercules, CA), XT Tricine running buffer (161–0790 ...
-
bioRxiv - Microbiology 2021Quote: ... Primers (Table 3) were designed using Primer3 Plus (31, 32) to quantify transcripts using Universal SYBR Green Supermix (Bio-Rad) using a Quantstudio 6 Flex (Applied Biosystems ...
-
bioRxiv - Cancer Biology 2021Quote: ... 3 μg of total RNA was used in the reverse transcription reaction using the iScript cDNA synthesis kit (Bio-Rad). Quantitative PCR amplification was performed on the Prism 7900 Sequence Detection System (Applied Biosystems ...
-
bioRxiv - Cell Biology 2021Quote: ... ± phosphatase inhibitor cocktail 3) and incubated for 30 min on ice before addition of MnCl2 and λ-phosphatase (Bio-Rad) to the appropriate samples for 30 min at 30°C ...
-
bioRxiv - Cell Biology 2021Quote: ... The membrane was subsequently washed 3 times in TBS+0.05 % Tween-20 over 45 min and incubated with secondary antibodies for 1 h at RT (20 °C) after washing 3 times in TBS+0.05 %Tween-20 and developed by enhanced chemiluminescence (Bio-Rad) with Image Quant™ LAS 4000.
-
bioRxiv - Cell Biology 2021Quote: ... Membranes were washed with PBS-T 3 times after each step and finally imaged on the ChemiDoc MP Imaging System (Biorad).
-
bioRxiv - Microbiology 2022Quote: The secretome samples were fractionated by one-dimensional SDS-PAGE with the Mini-protean® 3 kit (Bio-Rad, USA) using a 12% resolving gel and a 5% stacking gel at 200 V for 45 min ...
-
bioRxiv - Microbiology 2022Quote: ... 3-Hydroxypropionate samples were eluted through a 300 mm × 7.8 mm Aminex HPX-87H column (Bio-Rad, Hercules, CA, USA) at 55 °C using 5 mM H2SO4 (flow rate 0.6 mL/min ...
-
bioRxiv - Biochemistry 2022Quote: ... DNA and RNA were sheared through sonication and dotted (3 µg) on the nitrocellulose membrane (BIO-RAD, Cat No: 1620112). The membrane was baked at 80⁰C for 2 h and blocked-in phosphate-buffered saline (PBS-Tween 0.05% ...
-
bioRxiv - Cell Biology 2022Quote: ... and assays (Table S3) were used for real-time qPCR (Thermo Fisher, Applied Biosystems QuantStudio 3 and BioRad CFX 384) to determine CXCL12 ...
-
bioRxiv - Plant Biology 2022Quote: ... A total of 3 ml of Ni2+- loaded resin was packed into Econo-Pac columns (cat. Number 7321010 – Bio-Rad) and equilibrated with 3 column volumes (CV ...
-
bioRxiv - Plant Biology 2022Quote: ... the membrane was incubated 3 h with a solution containing a secondary goat-HRP anti rabbit (1:10 000) (Biorad) (milk 0.5 % TBST) ...
-
bioRxiv - Molecular Biology 2022Quote: ... at a ratio of 1:2 in 100 µL of TE by heating to 95°C for 3 min followed by cooling to 25°C at 0.1 °C/min in a T100 thermal cycler (Bio-Rad). In Figures ...
-
bioRxiv - Molecular Biology 2022Quote: ... and heating to 95°C for 3 min followed by cooling to 25°C at 0.1 °C/min in a T100 thermal cycler (Bio-Rad). Primer extension assays were performed either as time courses (up to 240 min ...
-
bioRxiv - Neuroscience 2022Quote: ... Blots were washed (3 × 5min TBS-T and 2 × 5 min TBS) before being imaged on the ChemiDoc MP Imaging System (Biorad). Subsequently ...
-
bioRxiv - Neuroscience 2023Quote: ... Free floating sections were blocked with 3% donkey serum and incubated overnight with rat anti-CD68 (1:200, Bio-Rad). Aβ deposition and CD68 staining were both developed with a Vectastain ABC kit and DAB reaction ...
-
bioRxiv - Cancer Biology 2024Quote: ... 3 μg of total RNA was used in the reverse transcription reaction using the iScript cDNA synthesis kit (Bio-Rad). Quantitative PCR amplification was performed on the Prism 7900 Sequence Detection System (Applied Biosystems ...
-
bioRxiv - Neuroscience 2022Quote: ... R primer: 5′-GTACCACCATGTACCCAGGC-3’) cDNA were amplified using the iScript RT-PCR iQ SYBR Green Supermix (BIORAD, Cat.:# 170882) in a qPCR detection system (LightCycler LC480 ...
-
bioRxiv - Cancer Biology 2024Quote: ... Quantitative PCR program was run on ABI QuantStudio 3 with iTaq Universal SYBR Green Supermix (#1725121, Bio-Rad, Hercules, CA,) using human Il6 and mouse B2m ...
-
bioRxiv - Cancer Biology 2023Quote: ... an equal volume of the cell suspension was added to the chamber of the counting slide (3 technical replicates) and counted with the TC20 automated cell counter (BioRad).
-
bioRxiv - Neuroscience 2023Quote: ... Membranes were washed with TBS-T (3 × 5 minutes) and incubated in horseradish peroxidase (HRP)-conjugated secondary antibody (1:1000) (BioRad) in blocking solution for 1 hour ...
-
bioRxiv - Immunology 2023Quote: ... Protein denaturation before separation was done by treating the cell lysates for 3 min at 95°C in presence of 1x XT Sample Buffer (BioRad) and 1x XT reducing agent (BioRad) ...
-
bioRxiv - Developmental Biology 2022Quote: ... was added to cells and incubated for 3 min prior to sorting into 384-well plates (Bio-Rad Laboratories, Inc) prefilled with lysis buffer using the Sony LE-SH800 cell sorter (Sony Biotechnology Inc) ...
-
bioRxiv - Developmental Biology 2023Quote: ... was added to cells and incubated for 3 min prior to sorting into 384-well plates (Bio-Rad Laboratories, Inc) prefilled with lysis buffer using the Sony LE-SH800 cell sorter (Sony Biotechnology Inc) ...
-
bioRxiv - Developmental Biology 2023Quote: ... Membranes were washed and blocked in 1x TBST with 5% bovine serum albumin before consecutive incubation with primary antibody (see Suppl. Table 3) and horseradish peroxidase-coupled protein A (Cymed) and detection using Clarity Western ECL Substrate (BioRad).
-
bioRxiv - Genetics 2022Quote: ... We washed the membrane 3× 5 minutes in TBS-T and 1× 5 minutes TBS before imaging (Bio-Rad ChemiDoc).
-
bioRxiv - Biochemistry 2023Quote: For VP protein analysis 3×109-1×1010 vg of purified AAV were mixed with 12.5 µl 4x Laemmli Sample Buffer (Bio-Rad, supplemented with 10% 2-mercaptoethanol ...
-
bioRxiv - Cancer Biology 2022Quote: ... 10-15 μg of protein samples and 3-5 μL of Precision Plus Protein Dual Color Standards (BIO-RAD, #1610374) were loaded in NuPAGE 4-12% Bis-Tris protein gels (Thermo Fisher Scientific ...
-
bioRxiv - Developmental Biology 2024Quote: ... For each condition 3 biological replicates with two technical replicate RT-qPCR reactions were run on a CFX96 Connect Real-Time System (BioRad). The number of il1b ...
-
bioRxiv - Neuroscience 2024Quote: ... The blot was washed 3 times with TBST for 5 minutes and was incubated with 10 mL of 3% BSA/TBST (w/v) with 1 µL anti-mouse-HRP secondary antibody (1:10,000; 170-6516, Bio-Rad) for 30 minutes at room temperature ...
-
bioRxiv - Neuroscience 2024Quote: ... The blots were washed in TBST (3 x 10 min) and scanned on a ChemiDoc MP imaging platform (Bio-Rad).29,30
-
bioRxiv - Zoology 2024Quote: ... on a 384 well-plate with 3 technical replicates per biological replicate in CFX384 Touch Real-Time PCR (Bio-Rad) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... with transfer buffer (14.4 g/l glycine, 3 g/l Tris base and 15 % methanol) using mini-wet electroblotting system (Bio-Rad) at 55 V for 130 min ...
-
bioRxiv - Biochemistry 2024Quote: ... We loaded 10 µL of proteins at 10 µM mixed in a 3:1 ratio with 4X Laemmli Buffer Sample (Biorad) provided with 10% DTT ...
-
bioRxiv - Microbiology 2020Quote: ... Samples were loaded onto a 4-20% Tris-glycine gel (MINI-Protean TGX Pre-cast, Bio-rad, 4561095) and run at 200 V for 15 min-1 hour ...
-
bioRxiv - Microbiology 2020Quote: Proteins were loaded and separated on a 4-20% Mini-Protean TGX Stain-Free precast protein gel (BioRad) and subsequently electrotransferred to a polyvinylidene difluoride (PVDF ...
-
bioRxiv - Cancer Biology 2021Quote: ... Real-time quantitative PCR was performed in 4 technical replicates with the SsoAdvanced Universal Probes Supermix (Bio-Rad) and detected with a Bio-Rad CFX Connect Real-Time PCR detection system ...