Labshake search
Citations for Bio-Rad :
2151 - 2200 of 3984 citations for Cis Dcca 100 Ug Ml In Acetonitrile D3 1 Carboxyl 13C2 99%; 1 D 97% since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2024Quote: ... 1 μg of RNA was used for reverse transcription using an iScript cDNA synthesis kit (Bio-Rad). cDNA was diluted 5 times in Milli-Q water and used as a template for PCR amplification using GoTaq G2 Green Master Mix (Promega ...
-
bioRxiv - Biochemistry 2024Quote: ... 1 µg of total RNA was converted into cDNA with iScript cDNA Synthesis Kit (Bio-Rad, 1708891) and 50 ng of cDNA was used in each reaction ...
-
bioRxiv - Molecular Biology 2024Quote: ... 1% agarose TBE gels and detected by trans-UV illumination using the Gel Doc XR+ (Bio-Rad) and Image Lab software (version 5.1) ...
-
bioRxiv - Immunology 2024Quote: ... cDNA was synthesized from ∼ 1 μg of extracted RNA using an iScript cDNA synthesis kit (Bio-Rad). RT-PCR was performed for IFNB and IL-1β on the Applied Biosystems PRISM 7500 qPCR machine ...
-
bioRxiv - Microbiology 2024Quote: ... the membrane was incubated with a 1:5,000 dilution of StrepTactin-horseradish peroxidase (HRP) conjugate (Bio-Rad), and 1:500 dilution of custom polyclonal antibodies (Cocalico Biologicals ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5’KI and 3’KI as detailed (Fig 2A and D) with the SsoAdvanced Universal SYBR Green Supermix (Bio-Rad). Briefly ...
-
bioRxiv - Genetics 2021Quote: ... Ras-related GTP binding D (Rragd) (forward, CACCTGAGCTTTTACCTGA; reverse, TCAGCAGATTCTCCAGCGTC) gene expression levels were quantified by SYBR-Green (Bio-Rad) on a CFX96 Real-Time PCR Detection System (Bio-Rad ...
-
bioRxiv - Biochemistry 2021Quote: ... Melting temperature was determined from the region of maximal slope as visualized by the first derivative of fluorescence with respect to temperature (minimal-d(RFU)/dT) per default behavior of Bio-Rad CFX manager software (BioRad).
-
bioRxiv - Biochemistry 2023Quote: ... 2mM DTT and 0.02% n-dodecyl-β-D-maltopyranoside [DDM]) buffer after transferring into Econo columns (Biorad, Cat. no. 7372512). Thrombin at concentration 1unit µL-1 was added to the resin slurry at 1:1 (dry resin:cleavage buffer ...
-
bioRxiv - Immunology 2024Quote: ... and RANTES/CCL5 (R&D Biotechne) according to the manufacturer’s protocol and analyzed using the Bio-Plex 200 platform (Bio-rad). Analyte concentrations were calculated using a standard curve (5 PL regression ...
-
bioRxiv - Bioengineering 2019Quote: ... DEAE and Sephadex G-100 were purchased from Bio-Rad (Hercules, CA) and Sigma-Aldrich (Saint Louis ...
-
bioRxiv - Microbiology 2020Quote: ... To remove metal ions MM was treated with 5% Chelex-100 (BioRad) for 24hr ...
-
bioRxiv - Cell Biology 2021Quote: ... PCR amplifications were carried out in the T-100 Thermal Cycler (Biorad). All assays included two positive controls samples and a no-template control (contained all reaction components except the genomic DNA) ...
-
bioRxiv - Molecular Biology 2022Quote: ... Immunoprecipitated DNA was recovered by first boiling with Chelex-100 resin (BioRad) for 12 min ...
-
bioRxiv - Evolutionary Biology 2022Quote: Genomic DNA was extracted from tissues using Chelex 100 (Bio-Rad, USA). Samples were incubated in 150 μL of 10% Chelex 100 for 60 min at 55 °C followed by 15 min at 95 °C ...
-
bioRxiv - Evolutionary Biology 2022Quote: 100 μl of protein G SureBeads™ magnetic beads (Bio-Rad, USA) were washed five times with 1× PBS (Phosphate-buffered saline) ...
-
bioRxiv - Cell Biology 2022Quote: ... and fixed cells were permeabilized with 0.1% Triton X-100 (Bio-Rad) in PBS for 5min ...
-
bioRxiv - Biophysics 2020Quote: ... In the morning ∼100 uL more Bio-Beads SM-2 (Bio-Rad) were added and 2x molar excess of FabDH4 ...
-
bioRxiv - Microbiology 2021Quote: ... resolved at 100 V and transferred to PVDF membrane (BIO-RAD, #1620177) in a wet electroblotting system ...
-
bioRxiv - Microbiology 2022Quote: ... prepared using the Chelex® 100 resin (Bio-Rad Laboratories, CA, USA), as reported by Hackel et al ...
-
bioRxiv - Cell Biology 2022Quote: ... pH 7.4) with 100 μl Bio-Gel P-4 Media (Bio-Rad). Islets were equilibrated at 2 mM glucose for 36-48 minutes prior to perfusion with amino acids or 10 mM glucose at 37ºC ...
-
bioRxiv - Cancer Biology 2019Quote: ... 0.1% Triton X-100 and 0.05% Tween 20 (Bio-Rad, 161-0781) in PBS ...
-
bioRxiv - Cell Biology 2020Quote: ... pH 7.4) with 100 µL Bio-Gel P-4 Media (Bio-Rad). Islets were equilibrated for 48 minutes ...
-
bioRxiv - Cell Biology 2020Quote: ... Cells were lysed in 100 μl 4x Laemmli lysis buffer (Bio-Rad) and collected using cell scraper ...
-
bioRxiv - Immunology 2019Quote: ... and 100 ng of RNA was reverse transcribed using iScript (Bio-Rad). Exon-spanning pre-developed assays for each of our targets were purchased from Thermo Fisher/Applied Biosystems ...
-
bioRxiv - Biochemistry 2020Quote: ... and permeabilized for one hour with 0.1% Triton X-100 (Biorad 1610407) supplemented with 1% BSA (Sigma) ...
-
bioRxiv - Microbiology 2021Quote: ... DNA from these samples was extracted using Chelex® 100 (Bio-Rad) after incubation of bisected and homogenized mosquitoes in 1% saponin in PBS.
-
bioRxiv - Biochemistry 2021Quote: ... and electro-blotted onto PVDF membranes (Biorad: 100 V, 2h, 4°C). The transferred proteins were then renatured by progressively reducing the guanidine-HCl concentration ...
-
bioRxiv - Neuroscience 2022Quote: ... permeabilized for 10 min with 0.5% Triton X-100 (Bio-Rad, USA) in phosphate buffered saline (PBS) ...
-
bioRxiv - Microbiology 2024Quote: Laboratory Standards Institute M100 Appendix I (using Chelex 100 resin, BioRad Laboratories) and verified to have a final iron concentration ≤ 0.03 mg/L (MilliporeSigma MQuant Iron Test Kit)(21 ...
-
bioRxiv - Molecular Biology 2024Quote: ... for 30 min at 100 V in 20 % methanol Towbin buffer (BioRad). Labeled proteins were visualized on the PVDF membrane using a Storage Phosphor screen (Molecular Dynamics ...
-
bioRxiv - Molecular Biology 2024Quote: ... 100 μg protein was mixed with 4x Laemmli sample buffer (Bio-Rad) and heated at 95 °C for 5 min ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 100 ng were retrotranscribed with iScriptTM cDNA synthesis kit (Bio-Rad) using random hexamers as primers ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... and anti-F4/80 FITC (3:100, Bio-Rad Laboratories, Temse, Belgium). The single cells were washed with 1XPBS+1%FBS ...
-
bioRxiv - Neuroscience 2023Quote: ... the genomic DNA was extracted with Chelex 100 Chelating Resin (1421253, BioRad). Briefly ...
-
bioRxiv - Molecular Biology 2024Quote: ... run at 100 V and transferred to nitrocellulose membranes (# 1704158, Bio-Rad). Blots were blocked in 5 % milk diluted in tris buffered saline plus 0.1 % Tween 20 (TBS-T ...
-
bioRxiv - Immunology 2019Quote: ... fatty acid free BSA Efflux was measured after a 4-hour incubation period with 0µg/ml and 50µg/ml of human HDL (#5685-2004, BioRad). Supernatants were collected and the cells lysed with 1% (w/v ...
-
bioRxiv - Synthetic Biology 2024Quote: ... was added into (Ribosome purification: 5 mL; PURE proteins purification: 2-3 mL) Econo-Pac chromatography columns (Biorad). The column was washed with 50 mL deionized Millipore water and charged with 15 mL 0.1 N Nickel sulphate solution ...
-
bioRxiv - Microbiology 2019Quote: ... Lungs were homogenized in D-PBS containing protease inhibitors to perform the cytokines quantification using a commercial multiplex mouse cytokine bead assay (Bio-Rad, Bio-Plex Pro Mouse Cytokine 23-plex Assay ...
-
bioRxiv - Cell Biology 2022Quote: ... as well as the level of cytokines in mouse serum, were assessed by using customized plates (Luminex assay, R&D) and analyzed on a Bio-Plex 200 instrument (Bio-Rad).
-
bioRxiv - Neuroscience 2022Quote: ... cDNA was synthesized using oligo-d(T) primers and avian reverse transcriptase (iScript cDNA Synthesis Kit, Bio-Rad, Hercules, CA, USA) according to the manufacturer’s instructions.
-
bioRxiv - Cancer Biology 2021Quote: ... Reverse transcription and qPCR was performed using the iTaqTM Universal SYBR® Green 1-Step Kit (BioRad 1725151) on a Bio-Rad CFX Connect Real-Time System ...
-
bioRxiv - Cell Biology 2019Quote: ... blots were incubated with 1: 5000 dilution of HRP-conjugated anti-mouse/ rabbit IgG secondary antibodies (Bio-Rad) in 1% milk-TBST for another hour ...
-
bioRxiv - Developmental Biology 2021Quote: ... The secondary incubation was performed with goat anti-rabbit IgG-HRP conjugate (1:3000) (Bio-Rad, Hercules, CA) or anti-mouse IgG-HRP conjugate (1:3000 ...
-
bioRxiv - Neuroscience 2021Quote: ... 1 μg of RNA was used to make cDNA with the iScript cDNA Synthesis Kit (Bio-Rad, 1708891). All primer pairs were designed and validated in-house for efficiency and specificity ...
-
bioRxiv - Neuroscience 2021Quote: ... membranes were rinsed and incubated with the fluorescent secondary antibodies StarBright Blue 700 anti-mouse (1:5.000, BioRad) and StarBright Blue 700 anti-rabbit (1:5.000 ...
-
bioRxiv - Molecular Biology 2021Quote: ... 1 μg of extracted RNA was transcribed into cDNA using the iScript Reverse Transcription Supermix kit (Biorad, 1708840). Quantitative RT-PCR was performed using the PerfeCTa SYBR Green SuperMix (Quantabio ...
-
bioRxiv - Genomics 2020Quote: ... Secondary antibody used were an HRP-conjugated goat anti-mouse or rabbit at 1:25,000 (BioRad, Hercules, CA).
-
bioRxiv - Genetics 2019Quote: ... followed by an anti-mouse (Abliance; 1/1,000) secondary antibody and then the Clarity Western ECL reagent (BioRad). Densitometric analysis was performed on non-saturated signals using the Image Lab™ software (BioRad).
-
bioRxiv - Physiology 2019Quote: ... containing the pre-formed Cas9/sgRNA ribonucleoproteins and loaded into a 1-mm electroporation cuvette (BioRad, 165-2089). Electroporation was performed using the GenePulser Xcell (BioRad ...