Labshake search
Citations for Bio-Rad :
2051 - 2100 of 9008 citations for 7 7a Dihydro 2 2 4 6 6 pentamethyl 1 3 benzodioxol 5 6H one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2023Quote: ... was added to the reactions and the products were separated on 4% polyacrylamide gels (ratio acrylamide:bisacrylamide 19:1, Bio-Rad) in TAE (40 mM Tris ...
-
bioRxiv - Microbiology 2023Quote: ... Membranes were stained with primary antibody in blocking buffer at 4°C overnight: anti-NP (1:5000, OBT1555, Bio-Rad), anti-PA ...
-
bioRxiv - Cell Biology 2024Quote: ... Samples were spun down at maximum speed for 1 minute and run on precast 4-20% gradient acrylamide gels (BioRad) in 1X Tris-Glycine buffer containing 0.1% SDS ...
-
bioRxiv - Microbiology 2024Quote: ... 7.5 mg of proteins was diluted in ChIP buffer supplemented with 0.01% SDS and precleared for 1 hr at 4°C with 50 μl of SureBeads Protein A Magnetic Beads (BioRad) and 100 μg bovine serum albumin (BSA) ...
-
bioRxiv - Biochemistry 2019Quote: ... supplemented with 0.02% pI 3-10 ampholites (BioRad). Isoelectric focusing was performed in a Protean™ IEF cell (Bio-Rad ...
-
bioRxiv - Cell Biology 2021Quote: ... After 3 washes with 0.05% tween20 (Bio-Rad) in TBS buffer (Bio-Rad) ...
-
bioRxiv - Cancer Biology 2021Quote: ... 5 µL of SybrGreen (BioRad) and 2.5 µL of primer-mix (800 nM ...
-
bioRxiv - Microbiology 2019Quote: ... 5 µl HF buffer (BioRad), 5 µl combinational enhancer solution (2.7 M betaine ...
-
bioRxiv - Neuroscience 2020Quote: ... Proteins were separated on 4%-15% or 4%-20% Criterion TGX precast protein gels (64134751; Bio-Rad), and transferred to an Immun-Blot PVDF membrane (1620177 ...
-
bioRxiv - Microbiology 2022Quote: ... Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was detected by using a 1:1,000 anti-GAPDH hFAB™ Rhodamine antibody (Bio-Rad, Hercules, CA) in 5% milk TBST (Tris buffer saline plus Tween-20) ...
-
bioRxiv - Bioengineering 2022Quote: ... The PVDF membrane was then washed 3 × 10 min with TBST and incubated with horseradish peroxidase (HRP)-conjugated goat anti-mouse (diluted 1:20,000; Bio-Rad, Hercules, CA) secondary antibody for one hour at room temperature followed by 6 × 10 min washes with TBST and detection using the Radiance Plus chemiluminescence substrate (Azure Biosystems ...
-
bioRxiv - Neuroscience 2023Quote: ... Sections were blocked using 5% BSA in PBS and incubated overnight at 4 °C with 1 or an appropriate combination of up to 3 of the following antibodies: rat anti-CD8 (1:500, catalog no. MCA609G; Bio-Rad Laboratories), rat anti-CD4 (1:1,000 ...
-
bioRxiv - Neuroscience 2023Quote: ... Samples were prepared for gel electrophoresis by adding a volume containing 20 ug protein to 3 uL 1 M DTT and 7.5 μL 4X Laemmli sample buffer (BioRad Cat. No. 1610747) and topping up to 30 μL with deionized water ...
-
bioRxiv - Biochemistry 2024Quote: ... were annealed at a ratio of 3:1 molar ratio Incubated at 93°C for 3 minutes and slowly cooling down in C1000 Touch™ Thermal Cycler (Bio-Rad). The pre-annealed RNA-TS (32 µM ...
-
bioRxiv - Molecular Biology 2022Quote: ... Secondary antibodies were incubated in 5% BLOT-QuickBlocker as follows: goat anti-mouse HRP conjugate (BioRad, 1706516; 1:5000), donkey anti-rabbit HRP conjugate (Amersham ...
-
bioRxiv - Bioengineering 2020Quote: The cDNA was diluted 1/5 with dH2O and 2.5 µL were used for qPCR analysis (10 µL total volume; BioRad, iTaq Universal SYBR Green Supermix ...
-
bioRxiv - Molecular Biology 2022Quote: ... cDNA was diluted 1/5 and analyzed by RT-qPCR using 2X iTaq Universal Sybr Green Supermix (Bio-Rad) and the oligonucleotides indicated in Table S2 ...
-
bioRxiv - Bioengineering 2021Quote: ... Cells were washed 3 times with PBS and then blocked for 1 hour at room temperature with DPBS with 0.4% Triton X-100 and 5% non-fat dry milk (BioRad). Cells were stained with primary and secondary antibodies (Table S3 ...
-
bioRxiv - Genomics 2021Quote: ... 1 μL diluted cDNA in a total volume of 5 μL using a CFX384 Real-Time System (Bio-Rad). For each sample we conducted three technical replicates and used their mean as the data point ...
-
bioRxiv - Neuroscience 2022Quote: ... for 1 minute and then imaging every 10 seconds for 5 minutes on the ChemiDoc XRS+ machine (Bio-Rad). ImageLab (Bio-Rad ...
-
bioRxiv - Genetics 2023Quote: ... The membrane was blocked 1 hr with 5% Blotting Grade Blocker Non-Fat Dry Milk (Bio-Rad, Cat# 1706404XTU) and incubated overnight with the primary antibodies [TTC3 Polyclonal Antibody (Abcam ...
-
bioRxiv - Bioengineering 2023Quote: ... cDNA was diluted 1:5 and RT-qPCR was done using SsoAdvanced™ Universal SYBR Green Supermix (Bio-Rad) with PrimePCR Assays (CCDC40 ...
-
bioRxiv - Molecular Biology 2024Quote: 0.2 – 1 mL (sufficient to cover the sample) of 5% Chelex 100 Resin (Bio-Rad Laboratories, Hercules, CA, USA) with 0.2% Tween20 and 0.1 mg/mL proteinase K (Merck ...
-
bioRxiv - Cancer Biology 2020Quote: ... PCR products were run in a 2% agarose slab gel and stained with ethidium bromide for visualization by UV shadowing (Bio-Rad Molecular Imager Gel Doc XR+).
-
bioRxiv - Cancer Biology 2020Quote: ... The plate was run on an ABI ViiA 7 instrument and analyzed with CFX manager software (Bio-Rad).
-
bioRxiv - Neuroscience 2023Quote: ... and transferred onto nitrocellulose at 25 V for 7 min using the Trans-blot Turbo system (Bio-Rad). Blotting efficiency was visualized by red Ponceau staining on membranes ...
-
bioRxiv - Biochemistry 2023Quote: ... and transferred at 1.3 A/25 V for 7 min using the Trans-Blot Turbo system (Bio-Rad). Afterwards ...
-
bioRxiv - Molecular Biology 2020Quote: ... The free and bound RNA bands were quantified using Quantity One software (Bio-Rad, Hercules, CA) and fit with the Hill equation in Prism.
-
bioRxiv - Biophysics 2019Quote: ... and quantitated by densitometry using a DNA standard curve and Quantity One® software (Bio-Rad).
-
bioRxiv - Biochemistry 2021Quote: ... Quantification of the images was performed using Quantity one and Gel doc XR from Biorad (Hercules).
-
bioRxiv - Neuroscience 2021Quote: ... Immunoblots were quantified by densitometric analysis of the fluorograms (Quantity One software; Bio-Rad, Hercules, CA) obtained in the linear range of the emulsion response.
-
bioRxiv - Microbiology 2021Quote: ... Multiplex RT-qPCR assay were carried out using Reliance One-Step Multiplex RT-qPCR Supermix (BioRad) or LightCycler Multiplex RNA Virus Master (Roche) ...
-
bioRxiv - Microbiology 2021Quote: ... Mixes were prepared according to the manufacturer’s instructions (iTaq Universal SYBR green One-Step kit, BioRad) with 1µL of RNA and a final concentration of 0.3µM of each primer.
-
bioRxiv - Microbiology 2021Quote: ... 2.5 ul of RNA was amplified using the iTaq Universal SYBR Green One Step kit (Biorad) and the following primers (SD29629:AGAAAACGCCGGTAGCAGAA and SD30197:CCTTCCCGAGCCTTCAACAT ...
-
bioRxiv - Molecular Biology 2020Quote: ... PCR products were quantified by densitometry analysis using the Bio-Rad Quantity One software (Bio-Rad). Fragments were pooled in an equimolar ratio ...
-
bioRxiv - Cancer Biology 2021Quote: ... Colony counting was performed using a Gel Doc Documentation System and Quantity One software (Bio-Rad) and quantification using Excel software.
-
bioRxiv - Cell Biology 2021Quote: ... Immunoblots in the linear range of detection were quantified using Quantity One software (Bio-Rad Laboratories).
-
bioRxiv - Cell Biology 2022Quote: ... Quantitative PCR was performed using the iScript one step RT-PCR SYBR green kit (Bio-Rad). RT-qPCR was performed in duplicate for each of three independent biological replicates ...
-
bioRxiv - Synthetic Biology 2022Quote: The qRT-PCR reaction was conducted using the iTaq Universeral Probes one-step kit (Bio-Rad) supplemented with SybrGreen I nucleic acid stain (Invitrogen) ...
-
bioRxiv - Neuroscience 2020Quote: ... Densitometric analysis was performed using Bio-Rad Quantity One software version 4.3.0 (Bio-Rad Laboratories, Inc.).
-
bioRxiv - Neuroscience 2020Quote: ... and protein immunoreactive bands quantified (Quantity One densitometry software or Image Lab software from Bio-Rad). WB data is presented as fold-increases of a control condition (stated in figure caption) ...
-
bioRxiv - Bioengineering 2019Quote: One hundred microliters of polyacrylamide resin containing different ratios of 40% acrylamide (Bio-Rad 161-0140) and 2%bis-acrylamide (Bio-Rad 161-0142 ...
-
bioRxiv - Neuroscience 2020Quote: ... One microgram of RNA was converted to cDNA using the iScriptTM cDNA synthesis kit (Bio-Rad). Primers for A1/A2 transcripts were ordered directly from Liddelow et al28 ...
-
bioRxiv - Microbiology 2021Quote: ... quantitative RT-PCR was performed using the iTaq Universal SYBR Green One-Step Kit (Bio-Rad) and the CFX Connect Real-Time PCR Detection System (Bio-Rad) ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... RT-qPCR was performed using iTaq Universal One-Step RT-qPCR Kits (Bio-Rad, cat.# 1725150). RT-qPCR primers were designed using Primer359 and are listed in Supplementary Table 13 ...
-
bioRxiv - Immunology 2021Quote: ... Products were analyzed by agarose gel electrophoresis in a ChemiDoc XRS-Quantity One Image Analyzer (BioRad)
-
bioRxiv - Cancer Biology 2022Quote: The protein expression was assayed and densitometric analysis was performed using quantity one software (Bio-Rad) as reported previously (11) ...
-
bioRxiv - Animal Behavior and Cognition 2022Quote: ... one microgram of isolated RNA was reverse transcribed using the iScript™ cDNA Synthesis Kit (BioRad). Using the DyNAmo HS SYBR green qPCR kit (F-410L ...
-
bioRxiv - Developmental Biology 2022Quote: ... Fraction bound was determined by densitometry of raw data using Quantity One® (v4.6.7, Bio-Rad) and the following equation for specific bands and then normalized ...
-
bioRxiv - Zoology 2022Quote: gRNA was quantified by RT-qPCR using the iTaq Universal probe one-step kit (Bio-Rad) with primers and probe targeting the DENV2 envelope [27] ...