Labshake search
Citations for Bio-Rad :
1951 - 2000 of 7095 citations for DNA Damage 8 OHdG ELISA Kit 5 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Systems Biology 2022Quote: DNA was extracted from tails or ears using Chelex resin (Bio-Rad, Hercules, CA). The genotype of mice was determined by PCR using the primers described in (Itoh et al ...
-
bioRxiv - Microbiology 2019Quote: ... PCR was performed using the iProof™ High-Fidelity DNA Polymerase (Bio-Rad, USA). Mini-CRISPR elements and plasmid pAY5211 were digested using the restriction enzymes KpnI and BamHI (NEB ...
-
bioRxiv - Biochemistry 2019Quote: ... DNA was introduced into freshly-prepared (electro)-competent cells by electroporation (Gene Pulser, BioRad).
-
bioRxiv - Genetics 2019Quote: DNA templates were amplified using iProof™ proof reader polymerase (BioRad, Hercules, CA, USA) (T7 and M13R-T7 primers were used for Dvvw) ...
-
bioRxiv - Microbiology 2020Quote: ... gallolyticus genomic DNA was prepared by resuspending cell pellets in InstaGene Matrix (Bio-Rad). Primers were synthesized by Integrated DNA Technology (IDT) ...
-
bioRxiv - Microbiology 2020Quote: ... and the DNA bands were visualized and recorded under a digital photodocumentation system (Biorad).
-
bioRxiv - Microbiology 2021Quote: ... Signals derived from hybridized DNA was detected using the Chemidoc MP system (Bio-rad).
-
bioRxiv - Microbiology 2021Quote: ... DNA was extracted with an equal volume of phenol:chloroform:isoamyl alcohol (25:24:1, BioRad), and traces of phenol were removed by triple extraction with equal volumes of chloroform:isoamyl alcohol (24:1) ...
-
bioRxiv - Plant Biology 2020Quote: ... The PCR was performed using the high-fidelity DNA polymerase “I proof” (Bio-Rad). The full genomic fragments were cloned into the pDONR221 (Invitrogen ...
-
The Polycomb group protein MEDEA controls cell proliferation and embryonic patterning in ArabidopsisbioRxiv - Developmental Biology 2020Quote: ... using 0.7μl of DNA per replicate and the SsoAdvanced Universal SYBR Green Supermix (BIORAD). Results are presented as H3K27me3 enrichment over H3 occupancy ...
-
bioRxiv - Cell Biology 2020Quote: ... and DNA bands were visualized using the ChemiDoc XRS+ System (Bio-Rad Laboratories, Incorporated).
-
bioRxiv - Biophysics 2021Quote: ... cellular RNA and DNA were detected using SYBR® Green fluorescence (BioRad, Cat# 1725124). An HBV- containing plasmid was used as a positive control and to produce the dilution series for the qPCR standards ...
-
bioRxiv - Genetics 2022Quote: ... we analyzed amplified DNA in droplets with a QX200 Droplet Reader (Bio-Rad Laboratories). In total we collected 180 pairs of measurements from 56 MA and control lines ...
-
bioRxiv - Plant Biology 2021Quote: ... and the genomic fragments were amplified with iProof high-fidelity DNA polymerase (Bio-Rad). The primer sequences for the GFP cloning are in Supplemental Table 2.
-
bioRxiv - Physiology 2021Quote: ... 20 ng of total DNA and the SYBR® Green Master Mix (Bio-Rad). b-Actin was amplified as an internal ...
-
bioRxiv - Immunology 2020Quote: ... 0.1 ng of template DNA was combined with 10 µL iQ supermix (Bio-Rad) and 2 µL each of 20 µM F primer ...
-
bioRxiv - Microbiology 2019Quote: ... PCR product was amplified in a DNA Engine Thermal Cycler (Bio-Rad, Sydney, Australia) and electrophoresed on a 1% agarose gel ...
-
bioRxiv - Microbiology 2019Quote: ... thaliana genomic DNA were quantified by qPCR on a qPCR cycler (CFX96, Bio-Rad) using SYBR Green (Invitrogen ...
-
bioRxiv - Molecular Biology 2019Quote: ... qPCR analysis of ChIP DNA was performed with iQ SYBR Green Supermix (Bio-Rad) on a CFX96 Real-Time System C1000 Thermal Cycler (Bio-Rad) ...
-
CHD7 interacts with the nucleosome acidic patch for its efficient activity via its N-terminal regionbioRxiv - Biochemistry 2020Quote: ... The amount of bound nucleosomes and DNA was measured with ChemiDoc MP (Bio-rad) using Image Lab software.
-
bioRxiv - Molecular Biology 2021Quote: ... DNA was amplified for 40 cycles on a cycler (model CFX96; Bio-Rad Laboratories) using SYBR Green PCR Master Mix (Applied Biosystems) ...
-
bioRxiv - Genomics 2021Quote: These reactions were undertaken on a DNA Engine Tetrad 2 Thermal Cycler (Bio-Rad), with MyTaq HS DNA polymerase ...
-
bioRxiv - Microbiology 2020Quote: ... The combined RBCs and DNA were transferred to a 0.2 cm cuvette (Bio-Rad) to be electroporated (Bio-Rad ...
-
Dual targeting factors are required for LXG toxin export by the bacterial type VIIb secretion systembioRxiv - Microbiology 2022Quote: ... intermedius B196 and GC1825 genomic DNA was prepared by using InstaGene Matrix (Bio-Rad) to extract and purify DNA from 2 mL of cells pelleted from an overnight culture ...
-
bioRxiv - Microbiology 2023Quote: ... Relative viral DNA levels were quantified by CFX96 real-time PCR instrument (Bio-Rad) with an All-in-one 2×qPCR mix (GeneCopoeia ...
-
bioRxiv - Microbiology 2023Quote: ... and used for complementary DNA synthesis with iScript Reverse Transcription Supermix (Bio-Rad 1708840), according to the manufacturers’ protocols ...
-
bioRxiv - Cancer Biology 2023Quote: ... ChIP’ed DNA was eluted using an elution buffer containing 1% SDS (Bio-Rad, 1610418) and 0.1M NaHCO3 (Merck ...
-
bioRxiv - Neuroscience 2023Quote: ... Complementary DNA (cDNA) was synthesized using iScript Reverse Transcription Supermix (Bio-Rad, 9170-8840) according to the manufacturer’s instructions and qPCR was performed using 5x iTaq Universal SYBR Green Supermix (Biorad ...
-
bioRxiv - Microbiology 2023Quote: ... genomic DNA was isolated from frozen co-culture pellets using Instagene matrix (Bio-Rad) and quantitative PCR (qPCR ...
-
bioRxiv - Microbiology 2023Quote: ... Quantitative PCR was conducted using the complementary DNA and SsoFast EvaGreen Supermix (Bio-Rad) using the manufacturer specifications for reaction preparation ...
-
bioRxiv - Genetics 2023Quote: ... DNA was extracted from tails by using Chelex resin (Bio-Rad Laboratories, Hercules, CA). Presence of ChrY was detected using primers that amplify Med14X and Med14Y (forward primer CCTCCAGACCCTATTACCAA ...
-
bioRxiv - Biophysics 2023Quote: ... plasmid DNA were transfected using 70 ul of Transfectin Lipid Reagent (BioRad, California, USA). 4 or 5 T175 plates were prepared for each plasmid DNA ...
-
bioRxiv - Bioengineering 2023Quote: ... Purification of DNA origami structures was performed by gel extraction (Freeze ‘N Squeeze, BioRad) or PEG precipitation (46) ...
-
bioRxiv - Molecular Biology 2024Quote: ... and different replication-associated DNA molecules were quantified using Quantity One 4.6 software (BioRad).
-
bioRxiv - Molecular Biology 2023Quote: ... and different replication-associated DNA molecules were quantified using Quantity One 4.6 software (BioRad).
-
bioRxiv - Immunology 2023Quote: ... The purified DNA were compartmented into oil droplets together with ddPCR Supermix (Bio-rad) as well as customized primers and probes using QX200 droplet Generator (Bio-rad ...
-
bioRxiv - Microbiology 2023Quote: ... Complementary DNA was prepared with iScript Reverse Transcription Supermix for qRT-PCR (Bio-Rad), and qRT-PCR was carried out with specific primers (Table S2 ...
-
bioRxiv - Microbiology 2023Quote: ... DNA-free RNA was used to generate cDNA using iScript reverse transcriptase supermix (BioRad), which was used to perform the quantitative PCR using QuantStudio (ThermoFisher) ...
-
bioRxiv - Bioengineering 2024Quote: ... coated with 10 μg of plasmid DNA using 1,100 psi rupture discs (Bio-Rad). Spectinomycin-resistant lines were selected on RMOP regeneration medium (Svab et al ...
-
bioRxiv - Cancer Biology 2024Quote: ... Immunoprecipitated DNA was analyzed by qPCR using iTaq Universal SYBR Green Supermix (Bio-Rad) using Primer 4 (Tang et al. ...
-
bioRxiv - Cell Biology 2023Quote: ... was transformed with the resultant DNA of the In-Fusion reaction by GenePulserII (BioRad) at 2.0 kV ...
-
bioRxiv - Cell Biology 2019Quote: ... Aurum Total RNA Mini Kit (BioRad) was used ...
-
bioRxiv - Developmental Biology 2021Quote: ... An iScript cDNA synthesis kit (BioRad) was used on 500ng of RNA for cDNA synthesis ...
-
bioRxiv - Developmental Biology 2021Quote: ... An iScript cDNA synthesis kit (BioRad) was used on 500ng of RNA for cDNA synthesis ...
-
bioRxiv - Molecular Biology 2021Quote: ... iScript cDNA synthesis Kit (Biorad, 1708891) was used to transcribe the isolated RNA to first strand cDNA ...
-
bioRxiv - Molecular Biology 2020Quote: ... using the iScript kit (Bio-Rad). qPCR was performed using PowerUp SYBR Green Master Mix (Thermo Fisher ...
-
bioRxiv - Cell Biology 2021Quote: ... and a colorimetric detection kit (BioRad).
-
bioRxiv - Microbiology 2021Quote: ... AP conjugate substrate kit (Bio-Rad) was used to develop spots ...
-
bioRxiv - Cancer Biology 2022Quote: ... The SsoFast EvaGreen Supermix kit (BioRad) was used for qRT-PCR using recommended cycling conditions ...
-
bioRxiv - Neuroscience 2022Quote: ... The iScriptTM cDNA Synthesis Kit (BioRad) was used to transcribe 500ng of total head RNA according to manufacturer’s instructions ...