Labshake search
Citations for Bio-Rad :
1951 - 2000 of 3426 citations for 1 Bromo 3 difluoromethoxy benzene since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2024Quote: ... The next day the assay plate was blocked with 1% casein blocking buffer (Bio-Rad) for 1 hr at RT ...
-
bioRxiv - Molecular Biology 2024Quote: ... The samples were resolved 1 cm into a 4-20% precast TGX gel (Biorad, 4561093), stained ...
-
bioRxiv - Neuroscience 2024Quote: The primary antibodies used were as follows: against MBP (rat monoclonal, MCA409S, BioRad, 1:300), Neurofilament-H (chicken polyclonal anti-NF-H ...
-
bioRxiv - Genomics 2024Quote: ... then embedded in an acrylamide gel (4% v/v 19:1 acrylamide:bis-acrylamide (Bio-Rad), 300 mM NaCl ...
-
bioRxiv - Biochemistry 2024Quote: ... Detergent was extracted by stirring suspensions overnight with 400 mg mL-1 BioBeads (Bio-Rad) at 4 °C ...
-
bioRxiv - Bioengineering 2024Quote: ... 1-5 µg of target protein was resuspended in 2× Laemmli Sample Buffer (Bio-Rad) with adding 1:20 Beta-mercaptoethanol and 15 µL of the mixture was added onto Any kD™ Criterion™ TGX Stain-Free™ Protein gel (Bio-Rad) ...
-
bioRxiv - Cancer Biology 2024Quote: ... Protein concentrations were determined using Quick Start Bradford 1× dye (Bio-Rad #5000205, California, USA), and sample concentrations were normalized ...
-
bioRxiv - Cell Biology 2024Quote: ... PCR products were visualized on a 1 % agarose gel (ChemiDoc MP Imaging System, Bio-Rad) and the amplicons were further purified (T1030L ...
-
bioRxiv - Cell Biology 2024Quote: ... PCR products were visualized on a 1% agarose gel (ChemiDoc MP Imaging System, Bio-Rad), purified (T1030L ...
-
bioRxiv - Cancer Biology 2024Quote: ... goat anti-rabbit IgG (H+L)-HRP conjugate (#1706515 Bio-Rad, 1:2500 for IB); goat anti-mouse (H+L)-HRP conjugate (#1706516 Bio-Rad ...
-
bioRxiv - Cancer Biology 2024Quote: ... Goat anti-mouse HRP conjugate was purchased from Bio-Rad (#170-5047, WB 1:5000), goat anti-rabbit (H+L ...
-
bioRxiv - Cell Biology 2024Quote: ... followed by the appropriate secondary antibody: anti-rabbit IgG (170-6515; Bio-Rad, 1:5,000) or anti-mouse IgG (170-6516 ...
-
bioRxiv - Cell Biology 2020Quote: ... X-ray film (Figs 1-5) and the ChemiDoc MP Imaging System (Bio-Rad, cat#17001402) (Supplemental Fig 3).
-
bioRxiv - Microbiology 2021Quote: ... Digested DNA fragments were then subjected to 1% agarose pulsed-field gel electrophoresis (PFGE) (Bio-Rad) using 0.5% Tris/Borate/EDTA (TBE ...
-
bioRxiv - Biochemistry 2022Quote: ... was added for 1 hour and membranes were imaged using Clarity Western ECL Substrate (Biorad, 1705061).
-
bioRxiv - Neuroscience 2021Quote: ... Total RNA (1 µg) was subjected to reverse transcription using Iscript reverse transcription supermix (Bio-Rad). cDNA levels were assayed by real-time PCR using iTaq universal SYBR green supermix (Bio-Rad ...
-
bioRxiv - Molecular Biology 2020Quote: ... We used horseradish peroxidase coupled secondary antibodies (α-mouse and α-rabbit, Bio-Rad, 1:2000). Blots were developed using an enhanced chemiluminescence kit (Amersham ...
-
bioRxiv - Bioengineering 2022Quote: ... or rat anti-F4/80 (rat anti-F4/80 antibody, 1:50, BioRad, MCA497GA, Hercules, CA). Cells were again washed in DPBS and incubated for 1 h at room temperature with Alexa Fluor® 488-conjugated secondary antibody (goat polyclonal antibody to rabbit IgG ...
-
bioRxiv - Immunology 2021Quote: ... with specific primers as listed in Table 1 and iTaq Universal SYBR Supermix (Bio-Rad, USA). The 10 µL reaction consisted of 5.0 µL 2X Supermix ...
-
bioRxiv - Developmental Biology 2020Quote: ... We ran the qPCR reactions using 1-2 µl cDNA in SYBR Green Master Mix (Biorad) totaling 20 µl in a Biorad CFX96 machine using 60°C as the annealing temperature ...
-
bioRxiv - Developmental Biology 2020Quote: ... Lysate aliquots with 16 µg protein were denatured in 1× Laemmli sample buffer (Bio-Rad, 1610747) for 5 min at 95°C ...
-
bioRxiv - Genetics 2020Quote: ... in 11 parallel transformations (1 mL each) on a Bio-Rad MicroPulser (Bio-Rad, #165-2100). The parallel transformations were combined and mixed with a total of 9.5 mL of recovery medium ...
-
bioRxiv - Biochemistry 2020Quote: ... The absorbance readings were collected at 260nm with a Econo UV Monitor (EM-1 220V, Biorad). After fractionation ...
-
bioRxiv - Neuroscience 2021Quote: ... or Goat Anti-Rabbit IgG (H L)-HRP Conjugate (1:1000; Bio-Rad; Catalog # 172-1019) in TBS-T for 1 hr at room temperature ...
-
bioRxiv - Cancer Biology 2020Quote: ... pH 7) for 30 min to 1 hr then assembled in a dot blot apparatus (BioRad). After washing with 100 μl TE buffer ...
-
bioRxiv - Cancer Biology 2020Quote: ... 1 µg of RNA was reverse transcribed to cDNA by iScript cDNA synthesis kit (BioRad #17088) as per the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2021Quote: ... and analyzed by Image Lab software (Bio-Rad, SOFT-LIT-170-9690-ILSPC-V-6-1). To measure the +1-frameshifting efficiency ...
-
bioRxiv - Biochemistry 2021Quote: ... the detergent was removed by adding 0.5 g mL-1 (w/v) Bio-Beads (Bio-Rad) overnight at 4°C ...
-
bioRxiv - Cell Biology 2021Quote: ... The assay medium was prepared by diluting 1 volume of alamarBlue dye reagent (BUF012A; Bio-Rad) in 9 volumes of growth medium ...
-
bioRxiv - Plant Biology 2021Quote: ... cDNA was synthesized from 1 μg total RNA using iScript cDNA synthesis kit (1706691, Bio-Rad). Transcript levels were analysed from three biological replicates by real time quantitative PCR (qRT-PCR) ...
-
bioRxiv - Microbiology 2020Quote: ... loaded onto a lab-made 8% TBE gel (Acrylamide/Bis solution 37.5:1, Bio-rad, 1610148), run at 200V for 1 hour ...
-
bioRxiv - Neuroscience 2020Quote: ... The following secondary antibodies were used: goat anti-rabbit HRP (1:5000, Bio-Rad: 170-5046) and goat anti-mouse HRP (1:5000 ...
-
bioRxiv - Microbiology 2021Quote: ... coli strain S17-1 using a Gene Pulser Xcell™ (Bio-Rad, Hercules, CA, United States) with the conditions of 2.5kV ...
-
bioRxiv - Molecular Biology 2021Quote: ... Secondary antibodies fused to HRP were used for detection (Goat anti-mouse HRP 1:3000, BioRad; Goat anti-rat HRP 1:3000 ...
-
bioRxiv - Neuroscience 2020Quote: ... Total RNA (1 μg) was subjected to reverse transcription using Iscript reverse transcription supermix (Bio-Rad). cDNA levels were assayed by real-time PCR using iTaq universal SYBR green supermix (Bio-Rad ...
-
bioRxiv - Microbiology 2021Quote: ... RNA (1 μg) was reverse transcribed using an iScript gDNA Clear cDNA synthesis kit (Bio-Rad). Quantitative PCR was performed with SYBR green (SsoAdvanced ...
-
bioRxiv - Molecular Biology 2020Quote: ... HRP-conjugated Goat Anti-Rabbit IgG (H+L) (1:1000, 170-6515, Bio-Rad, CA, USA) or Goat-anti-Mouse IgG (1:1000 ...
-
bioRxiv - Microbiology 2020Quote: ... qPCRs were then performed with 1 μl of cDNA using Universal SYBR green Supermix (BIO-RAD). Primer sets used for real-time PCR analysis are qcopA forward (CAATACCCTGGTGGTCGATAAAAC ...
-
bioRxiv - Microbiology 2020Quote: ... and 1: 25000 diluted secondary HRP conjugated Goat anti-mouse IgG (H+L) (BioRad, Mississauga, Canada). The blot was developed using Clarity Western ECL substrate (BioRad ...
-
bioRxiv - Pathology 2022Quote: ... Total RNA (1 mg) was reverse-transcribed using iScript select cDNA synthesis kit (Bio-Rad, USA) as per manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2022Quote: ... at 1:3000 dilution and with the ladder conjugate (Precision Protein StrepTactin-HRP Conjugate, Bio-Rad) at 1:5000 dilution ...
-
bioRxiv - Genetics 2022Quote: ... The membranes were blocked with 1x Tris buffered saline with 1% casein (Bio-Rad, Cat #: 1610782) for 1 hour at room temperature ...
-
bioRxiv - Developmental Biology 2022Quote: ... First-strand cDNA was generated from 1 μg total RNA using the iScript cDNA kit (BioRad) with a poly-T primer as described in the kit’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... Boiled samples were diluted 1:1000 and subsequently used as templates for IQ SYBR (Bio-Rad) qPCR reactions ...
-
bioRxiv - Genomics 2022Quote: 1 µg of total RNA was reverse transcribed using iScript reverse transcription supermix (Biorad, Solna, Sweden). RT-qPCR was performed using a LightCycler 96 and the SYBR green master mix (Roche ...
-
bioRxiv - Cancer Biology 2020Quote: ... Quantitative RT-PCR was performed using the iTaq Univer SYBR Green 1-Step Kit (Bio-Rad) on a StepOnePlus Real-time PCR system (Applied BioSystem) ...
-
bioRxiv - Microbiology 2020Quote: ... The plates were washed and incubated with mouse anti-His (Bio-Rad MCA-1396; 1:1000) followed by horseradish peroxidase (HRP)-conjugated goat anti-mouse secondary antibody (MerckMillipore AP124P ...
-
bioRxiv - Microbiology 2021Quote: ... total RNA (1 µg) was reverse-transcribed using the iScript™ Reverse Transcription Supermix (Bio-Rad) as recommended by the manufacturer ...
-
bioRxiv - Plant Biology 2021Quote: ... Electroporation was performed using a cuvette with a width of 1 mm and an electroporator (Biorad) with the settings ...
-
bioRxiv - Biophysics 2020Quote: ... Nanodisc reconstitution was achieved by incubation with 0.5 - 1 mL Bio-Beads SM-2 (Bio-Rad) for 16 hours at 4°C under constant rotation ...