Labshake search
Citations for Bio-Rad :
151 - 200 of 2910 citations for Upstream stimulatory factor 2 USF2 Antibody HRP since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2020Quote: ... followed by HRP-labelled anti-mouse or anti-rabbit IgG antibody (BioRad). Intensity of protein bands were quantified using Adobe Photoshop.
-
bioRxiv - Neuroscience 2021Quote: ... secondary goat anti-mouse horseradish peroxidase (HRP)-conjugated antibody (Bio-Rad, #1705047); secondary goat anti-rabbit HRP-conjugated antibody (Bio-Rad ...
-
bioRxiv - Neuroscience 2020Quote: ... membranes were transferred to goat anti-rabbit HRP-conjugated secondary antibody (BioRad), diluted in blocking solution for an hour at room temperature ...
-
bioRxiv - Cancer Biology 2022Quote: ... membranes were incubated with the appropriate HRP-linked secondary antibodies (Bio-Rad) at room temperature for 45 min ...
-
bioRxiv - Molecular Biology 2019Quote: ... Secondary antibodies used were HRP-conjugated Goat Anti-Rabbit (BioRad, 170-6515) and Anti-Mouse (BioRad ...
-
bioRxiv - Biochemistry 2019Quote: ... An HRP-conjugated goat anti-rabbit antibody (Biorad, Cat. No. 170-6515) was applied as the secondary antibody in all cases ...
-
bioRxiv - Systems Biology 2020Quote: ... of horseradish peroxidase-conjugated (HRP) antibodies (anti-rabbit, 170-5046, Bio-Rad, Hercules ...
-
bioRxiv - Immunology 2020Quote: ... HRP conjugated goat anti-rabbit IgG secondary antibody (5196-2504, Bio-rad) was used for detection ...
-
bioRxiv - Cell Biology 2021Quote: ... HRP-conjugated antibodies against mouse and rabbit were purchased from Bio-Rad Laboratories (1:5000)
-
bioRxiv - Biochemistry 2020Quote: ... probed with goat-anti rabbit HRP conjugate antibody (1:3000) (Bio-Rad) in TBST/5% wt/vol non-fat milk (1 h ...
-
bioRxiv - Plant Biology 2022Quote: ... The secondary antibody used was anti-rabbit IgG-HRP conjugate (BIO-RAD). ECL Prime Western blotting detection reagent (Cytiva ...
-
bioRxiv - Plant Biology 2022Quote: ... the second antibody goat anti-mouse IgG-HRP conjugate (Bio-Rad, #1706516) was diluted at 1:10000 ...
-
bioRxiv - Biochemistry 2023Quote: ... Horseradish peroxidase (HRP) conjugated antibodies were detected with Clarity ECL Substrate (Biorad) on a ChemiDoc (Biorad) ...
-
bioRxiv - Genomics 2023Quote: ... Secondary antibody: Goat Anti-Mouse IgG (H + L)-HRP Conjugate (BioRad, 1706516).
-
bioRxiv - Immunology 2023Quote: ... Antibodies were detected with either anti-mouse IgG-HRP (STAR120P, Bio-Rad), anti-mouse IgG1-HRP (STAR132P ...
-
bioRxiv - Biochemistry 2023Quote: ... or anti-rabbit HRP-antibodies (dilution 1 to 3000, #1706515, Bio-Rad).
-
bioRxiv - Biophysics 2023Quote: ... for the anti-RpoC condition or GAR-HRP secondary antibody (BioRad #1705046) for the anti-mChery condition for one hour with gentle agitation ...
-
bioRxiv - Genomics 2023Quote: ... The membrane was washed and incubated with HRP-conjugated secondary antibodies (BioRad) at room temperature for 1 h ...
-
bioRxiv - Cancer Biology 2023Quote: ... Membranes were incubated with IgG HRP-conjugated secondary antibody (Bio-Rad Laboratories) for 1 hour at room temperature ...
-
bioRxiv - Immunology 2023Quote: ... HRP-conjugated secondary antibody was added followed by chemiluminescence imaging (ChemiDoc, BioRad).
-
bioRxiv - Neuroscience 2023Quote: ... membranes were incubated with HRP-conjugated secondary antibodies (1:5000, Bio-Rad: Immune-star goat anti-rabbit HRP conjugate ...
-
bioRxiv - Cell Biology 2020Quote: ... Membranes incubated with HRP (horseradish peroxidase)–conjugated antibodies (HRP rabbit, 111 035 144; HRP mouse, 115 035 146) were developed using Clarity western ECL substrate solutions (Bio-Rad) with a ChemiDoc XRS+ imaging system (Bio-Rad).
-
bioRxiv - Molecular Biology 2019Quote: ... Membranes were incubated with HRP-conjugated secondary antibodies for both FLAG and GFP stainings (Rabbit anti-goat-HRP conjugate, #1721034, Bio-Rad) diluted at 1:5000 ...
-
bioRxiv - Molecular Biology 2019Quote: ... were purchased from Thermo Fisher Scientific while secondary antibodies Goat anti-mouse HRP (172-1011) and Goat anti-rabbit HRP (170-8241) were from Bio-Rad. MG132 (C2211 ...
-
bioRxiv - Cell Biology 2022Quote: ... Primary antibodies were detected by using horseradish peroxidase (HRP)-conjugated secondary antibodies (goat anti-mouse IgG (H+L)-HRP conjugate (1:10,000, Bio-Rad #1706516), goat anti-rabbit IgG (H+L)-HPR conjugate (1:10,000 ...
-
bioRxiv - Physiology 2023Quote: ... The secondary antibodies were goat anti-mouse IgG-HRP and goat anti-rabbit IgG-HRP conjugate (Bio-Rad, Hercules, CA, USA) for western blotting ...
-
bioRxiv - Physiology 2023Quote: ... Blotted bands were detected using HRP conjugated secondary antibodies goat anti-rabbit conjugated with HRP (#1706515, Bio-Rad, 1:15, 000). ImageJ was used to calculate the fluorescence density of each band ...
-
bioRxiv - Microbiology 2020Quote: ... Primary antibodies were detected with a horseradish peroxidase (HRP)-conjugated secondary antibody (1:3000, #170-6515, Biorad or #12-349 ...
-
bioRxiv - Cell Biology 2022Quote: ... as a primary antibody and HRP conjugated goat anti-mouse IgG secondary antibody (BIO-RAD, Catalog # #1706516). Chemiluminescence was detected using film for figure S1 and an Azure c400 imaging system (Azure Biosystems ...
-
bioRxiv - Cell Biology 2023Quote: ... The following secondary antibodies were used for immunoblotting: anti-rabbit HRP-linked IgG antibody (5196-2504, BioRad) and anti-mouse HRP-linked IgG antibody (7076 ...
-
bioRxiv - Microbiology 2023Quote: ... Secondary antibodies used are goat anti-rabbit HRP conjugated antibodies (dilution 1:10,000) (BioRad Cat. No. 1706515) and goat anti-rabbit HRP (BioRad Cat ...
-
bioRxiv - Immunology 2021Quote: ... Virus plaques were visualised by immunostaining with a rabbit polyclonal anti-NSP8 antibody (ABIN233792; Antibodies Online) and an HRP-conjugated anti-rabbit antibody (1706515; Bio-Rad). Plaques were quantified and IC50 values calculated using LabView or SigmaPlot software as previously described (28) ...
-
bioRxiv - Cell Biology 2020Quote: The ddPCR primer mix for amplifying upstream of the sgRNA integration region was purchased from BioRad: Gaagaagaaggtggagagagagacagagacagatccattcgattagtgaacggatcggcactgcgtgcgccaattct gcagacaaatggcagtattcatccacaattttaaaagaaaagggggg (FAM ...
-
bioRxiv - Cancer Biology 2022Quote: ... slides were washed twice with PBS and incubated with secondary antibodies (Desmin and MYOD1: anti-rabbit-HRP, BioRad 170-6515; Myogenin: anti-mouse HRP, BioRad 170-6516) 1:500 in PBS-1% BSA ...
-
bioRxiv - Cancer Biology 2022Quote: ... membranes were incubated with complementary HRP conjugated secondary antibody (sheep anti-mouse IgG-HRP, 1:10000, GE Healthcare, NA931; goat anti-rabbit IgG-HRP, 1:5000, Bio-Rad, 1706515 ...
-
bioRxiv - Immunology 2020Quote: ... but using a rabbit polyclonal anti-NSP8 antibody (Antibodies Online; ABIN233792) and anti-rabbit-HRP conjugate (Bio-Rad) and detected using HRP on a TMB based substrate ...
-
bioRxiv - Cell Biology 2021Quote: ... primary antibodies were used and detected using HRP-conjugated anti-rabbit or anti-mouse secondary antibodies (Bio-rad). The target bands were stained with Immobilon Western Kit (Millipore ...
-
bioRxiv - Cancer Biology 2021Quote: ... Secondary HRP-conjugated antibodies targeting mouse and rabbit IgG were purchased from Biorad.
-
bioRxiv - Neuroscience 2021Quote: ... Secondary antibodies were goat anti-rabbit HRP (1:5000, Bio-Rad: 170-5046) and goat anti-mouse HRP (1:5000 ...
-
bioRxiv - Biochemistry 2020Quote: ... Proteins were detected using HRP-conjugated antibodies and enhanced chemiluminesence reagent (Bio-Rad). Band intensities were quantified using ImageJ software.
-
bioRxiv - Cancer Biology 2020Quote: ... and a secondary antibody (goat anti-rabbit HRP, Bio-Rad, AB_11125142; 1:2,000) were used in these experiments.
-
bioRxiv - Neuroscience 2022Quote: ... Secondaries for immunoblots were HRP-conjugated rabbit antibodies (Bio-Rad Laboratories, 1:10000).
-
bioRxiv - Microbiology 2022Quote: ... membranes were treated with secondary antibody goat anti-rabbit IgG-HRP (Bio-Rad) at a concentration of 1:3000 ...
-
bioRxiv - Cell Biology 2022Quote: ... Species-specific anti-IgG antibodies conjugated to HRP (Bio-Rad, Richmond, CA, USA) or IRDye 800CW and IRDye 680RD secondary antibodies (LI-COR Biotechonology ...
-
bioRxiv - Neuroscience 2022Quote: ... HRP-conjugated secondary antibodies (anti-mouse and anti-rabbit (both 1:3000, BioRad) were used and revealed with chemiluminescence (Amersham ECL Western Blotting Detection Reagents).
-
bioRxiv - Genetics 2022Quote: ... followed by an HRP-conjugated secondary antibody (Bio-Rad 1706515; 1:3000 dilution) before applying ECL HRP substrate (Bio-Rad 1705060 ...
-
bioRxiv - Cell Biology 2022Quote: ... For western blots secondary antibodies coupled to HRP (Bio-Rad and GE-Healthcare) at 1:10.000 dilution were applied (Sheep anti-Mouse ...
-
bioRxiv - Cell Biology 2019Quote: Secondary antibodies conjugated to horseradish peroxidase (HRP): Goat anti-rabbit (BioRad #170-6515), Donkey anti-mouse (Jackson Immunoresearch Laboratories 713-035-147) ...
-
bioRxiv - Neuroscience 2019Quote: ... Protein bands were visualized using horse radish peroxidase (HRP)-coupled secondary antibodies (BioRad) and SuperSignal West Dura solution as substrate (Thermofisher) ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... followed by incubation with corresponding HRP-conjugated secondary antibodies (Bio-Rad or Abcam) for 1 h at room temperature ...