Labshake search
Citations for Bio-Rad :
151 - 200 of 488 citations for Siglec 6 Human HEK 293 Fc since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2024Quote: ... The reaction was cleaned up by P-6 Micro Bio-Spin Column (Bio-Rad). For fluorophore labeling ...
-
bioRxiv - Immunology 2024Quote: RNA from 5×10^6 splenocytes was extracted with the RNeasy Mini Kit (BioRad) and converted to cDNA using the Maxima First Strand cDNA Synthesis Kit (ThermoFisher Scientific) ...
-
bioRxiv - Microbiology 2024Quote: ... The 10 µl reactions were purified with Bio-Spin® 6 Columns (Bio-Rad), and mixed with 10 µl of RNA loading dye (95% formamide ...
-
bioRxiv - Immunology 2022Quote: ... Pre-designed human gene primers were purchased from Bio-Rad (supplemental Table). Human PPIA was amplified in parallel and used as the reference gene in quantification ...
-
bioRxiv - Biochemistry 2020Quote: ... with goat anti-human IgG F(ab’)2-HRP (STAR126P, Bio-Rad) as the detection antibody.
-
bioRxiv - Biophysics 2020Quote: ... and mouse anti-human CD34 (QBEND 10 clone, Ms IgG1, Bio-Rad). Briefly ...
-
bioRxiv - Cancer Biology 2022Quote: ... Human primers for HLA-DRB1 and VCAM1 were purchased from Bio-Rad.
-
bioRxiv - Immunology 2020Quote: ... and incubated with either FITC-conjugated Sheep Anti-Human C3 (BioRad AHP031F) at 1:500 or AF488-conjugated Mouse Anti-C5b-9 (ae11 ...
-
Antiviral roles of interferon regulatory factor (IRF)-1, 3 and 7 against human coronavirus infectionbioRxiv - Microbiology 2022Quote: ... human IFN-γ and IFN-λ 1 were obtained from Bio-Rad, BD Pharmingen and R&D Systems respectively ...
-
bioRxiv - Cancer Biology 2023Quote: ... and G-CSF quantification using a human Bio-plex PRO assay (Biorad) following the manufacturer’s instructions and acquired with the Luminex200 instrument (Luminex).
-
bioRxiv - Immunology 2023Quote: ... with human IgA positive and negative controls (Bio-Rad, Cat No. 12014775), Bio-Plex SARS-CoV-2 Wuhan-1 strain RBD and N coupled beads (Bio-Rad ...
-
bioRxiv - Immunology 2023Quote: ... A human RPP30 copy number assay labeled with HEX (Bio-Rad, dHsaCP1000485) was used to measure total allelic copy numbers ...
-
bioRxiv - Physiology 2023Quote: Human recombinant monoclonal antibodies to mouse ERFE were produced by Bio-Rad using HuCAL technology ...
-
bioRxiv - Physiology 2023Quote: Human recombinant monoclonal antibodies to mouse ERFE were produced by Bio-rad using the HuCAL technology ...
-
bioRxiv - Molecular Biology 2020Quote: ... The adaptor was cleaned up on a Micro Bio-Spin 6 chromatography column (Bio-Rad) equilibrated with water ...
-
bioRxiv - Microbiology 2019Quote: ... Excess [γ-32P] ATP was removed with a Bio-Spin 6 column (Bio-rad, CITY). Followed by heat inactivation ...
-
bioRxiv - Biochemistry 2022Quote: ... with the mini profinity IMAC and mini Bio-Gel P-6 desalting cartridges (Bio-Rad). The protein concentration and purity were verified by Bradford Protein Assay (Bio-Rad ...
-
bioRxiv - Biochemistry 2022Quote: ... 10mM BME) at room temperature using Micro Bio-Spin 6 columns (Bio-Rad CAT# 7326200). PARLSkd3 concentration was measured via A280 and the molar extinction coefficient and PARLSkd3 concentration was adjusted to 30 μM ...
-
bioRxiv - Developmental Biology 2019Quote: ... and 6 μl freshly prepared Ammonium persulfate (Bio-Rad, 10 mg in 100μl distilled water) were added to the solution and mixed ...
-
bioRxiv - Neuroscience 2020Quote: ... and 10 μg of protein was loaded onto an acrylamide gel (6–15%; Bio-Rad). Gel electrophoresis was performed in Tris- glycine-sodium dodecyl sulfate (SDS ...
-
bioRxiv - Biochemistry 2021Quote: ... Bio-Beads SM-2 Resin and Bio-Gel P-6 were obtained from Bio-Rad Laboratories Inc ...
-
bioRxiv - Animal Behavior and Cognition 2021Quote: ... Labeled probes were then purified using Micro Bio-Spin 6 Chromatography Column (BioRad, Berkeley, CA), and 1 μl of the probe was counted for subsequent radioactivity dilution calculations ...
-
bioRxiv - Biophysics 2020Quote: ... 0.5% n-dodecyl-β-D-maltoside using a Bio-Spin 6 desalting column (Bio-Rad). CmeC (5 μM ...
-
bioRxiv - Genomics 2020Quote: ... cDNA was diluted 1:6 and run with iTaq Universal SYBR Green Supermix (Bio-Rad) on ViiA 7 Real-Time PCR System according to manufacturer protocol ...
-
bioRxiv - Biophysics 2022Quote: ... The modified probes were purified using a P-6 Micro Bio-Spin Column (Bio-Rad).
-
bioRxiv - Molecular Biology 2023Quote: ... The RNA probe was purified using Micro Bio-Spin™ P-6 Gel Columns (Biorad), denatured 5 min in 95°C and cooled on ice ...
-
bioRxiv - Immunology 2022Quote: ... using the magnetic rack (6-Tube SureBeads™ Magnetic Rack #1614916 BIORAD Hercules, CA, USA) to magnetized them ...
-
bioRxiv - Microbiology 2023Quote: ... anti-CD45-APC (clone UM16-6, LYNX Rapid APC Antibody Conjugation Kit, both Bio-rad) and thrombocyte marker K1-PE (LYNX Rapid RPE Antibody Conjugation Kit ...
-
bioRxiv - Biochemistry 2020Quote: ... Detection antibodies used: anti-human F(ab’)2 IgG-HRP (STAR126P, Bio-Rad), anti-His5-Tag IgG-HRP (MCA5995P ...
-
bioRxiv - Biochemistry 2020Quote: ... Detection antibodies used: anti-human F(ab’)2 IgG-HRP (STAR126P, Bio-Rad), anti-His5-Tag IgG-HRP (MCA5995P ...
-
bioRxiv - Microbiology 2022Quote: ... and Bio-Plex Pro Human Cytokine 27-plex assay (Bio-Rad, California, USA) were used to detect urinary cytokines ...
-
bioRxiv - Microbiology 2022Quote: ... and a goat anti-human IgG conjugated to HRP (Bio-Rad, cat. 204005) was used as secondary antibody ...
-
bioRxiv - Immunology 2021Quote: ... Supernatants were analyzed using a human Th17 cell cytokine panel multiplex (BioRad 171AA001M). For flow cytometry ...
-
bioRxiv - Bioengineering 2020Quote: ... or AlexaFluor647-conjugated mouse-anti-human CD120a (TNFR1) antibodies (clone H398, Bio-Rad). DAPI was used for dead cell exclusion.
-
bioRxiv - Immunology 2023Quote: ... and Bio-Plex Pro Human IgA detection antibody (Bio-Rad, Cat No. 12014669). For both kits ...
-
bioRxiv - Pathology 2023Quote: ... Immunoglobulins were analysed using a bio-plex pro human isotyping assay (Bio-Rad) according to manufacturer instructions ...
-
bioRxiv - Molecular Biology 2021Quote: ... 150 mM NaCl and 1mM DTT using Micro Bio-SpinTM P-6 Gel Columns (Bio-Rad). Protein concentration was determined by NanoDrop ...
-
bioRxiv - Molecular Biology 2019Quote: ... While 6-FAM labelled constructs were directly visualized under UV in gel documentation system (Bio-Rad), unlabelled constructs were visualized after staining with ethidium bromide (EtBr).
-
bioRxiv - Biophysics 2019Quote: ... P-6 (7326221) and P-30 (7326223) Micro Bio-Spin columns were obtained from Bio-Rad.
-
bioRxiv - Biochemistry 2019Quote: ... The supernatant was collected and DTT was removed by a Bio-Spin 6 column (Bio-rad) which was pre-equilibrated with 50 mM NaPi ...
-
bioRxiv - Genetics 2021Quote: ... The free [γ-32P]ATP was removed by the use of Bio-Spin 6 column (Biorad) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2020Quote: ... 0.03% (w/v) DDM) using a centrifugal buffer exchange device (Micro Bio-Spin 6, Bio-Rad) as previously described43 ...
-
bioRxiv - Biochemistry 2021Quote: ... and analyzed by Image Lab software (Bio-Rad, SOFT-LIT-170-9690-ILSPC-V-6-1). To measure the +1-frameshifting efficiency ...
-
bioRxiv - Cancer Biology 2022Quote: ... Labeled antibodies were purified by size exclusion chromatography using Bio-Spin 6 columns (Bio-Rad, 7326200) followed by measurement of protein concertation using Nanodrop 2000 at 260 nm.
-
bioRxiv - Cell Biology 2022Quote: ... Following cleanup of the sgRNAs using Micro Bio-Spin 6 columns (#7326221; Bio-Rad, Hercules, CA) and quantification ...
-
bioRxiv - Biochemistry 2020Quote: ... the samples were passed through a Micro Bio-Spin 6 Chromatography column (Bio-Rad, Cat#7326222), sonicated ...
-
bioRxiv - Biophysics 2021Quote: ... Excess Sulfo-SMCC was removed three times by gel filtration (Micro BIO- SPIN P-6, Biorad), mixed with thiol-modified DNA oligonucleotide (CTCTCCTCTCCACCATATCCA ...
-
bioRxiv - Biochemistry 2021Quote: ... Bio-Scale Mini Bio-Gel P-6 desalting cartridge was obtained from Bio-Rad (Hercules, CA). All UV-Vis measurements were taken using Cary 100 Bio UV-Vis from Agilent (Santa Clara ...
-
bioRxiv - Molecular Biology 2021Quote: ... PCR products were separated on nondenaturated 6% polyacrylamide gels and imaged by ChemiDoc system (Bio-Rad).
-
bioRxiv - Physiology 2021Quote: ... Relative protein abundance (N=6-8) were quantified using the Image Lab software (version 6.0.1; BioRad) and normalized by the protein content in each lane.