Labshake search
Citations for Bio-Rad :
151 - 200 of 4615 citations for Rat Insulin Like 3 INSL3 CLIA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2024Quote: ... a rat anti-mouse CD206 primary antibody (Bio-Rad, USA), or a rat anti-mouse F4/80 primary antibody (Abcam ...
-
bioRxiv - Plant Biology 2021Quote: ... thaliana (5’-CAGGCGGTGGAAACTACCAAG-3’ and 5’-TACAGCACTGCACGGGTCGAT-3’) and R129_E (5’-CGAGCTAATCTCCAAAAGCCATC-3’ and 5’-TGACCCTACCGTGGTTAGCTG-3’) with iQ SYBR Green Supermix (BIO-RAD), as described previously (Garrido-Oter et al. ...
-
bioRxiv - Immunology 2023Quote: ... 5’ GACGTGGGCTCCTTACACTGA 3’)(41) and 18s (Fwd: 5’ CTTAGAGGGACAAGTGGCG 3’, Rev: 5’ ACGCTGAGCCAGTCAGTGTA 3’)(42) using the SsoFast assay system (BioRad) was used to quantify transcripts in a BioRad CFX94 machine.
-
bioRxiv - Molecular Biology 2020Quote: ... CHAPS (3-((3-cholamidopropyl) dimethylammonio)-1-propanesulfonate) were purchased from Bio-Rad Laboratories ...
-
bioRxiv - Synthetic Biology 2021Quote: ... serum insulin was performed using the Bio-Plex Pro Mouse Diabetes 8-Plex Assay (Bio-Rad, Hercules, CA) as per the manufacturer’s protocol.
-
bioRxiv - Cancer Biology 2019Quote: ... ScRNA-Seq libraries were prepared using SureCell WTA 3’ Library Prep Kit for the ddSEQ System (Illumina/Bio-Rad) according to manufacturer’s manual ...
-
bioRxiv - Cell Biology 2024Quote: ... Caspase activity was measured as described in the FAM FLICA caspase 1 and 3 kit (Bio-Rad, Hercules, USA). Lysosomal and mitochondrial content as well as production of ROS were analysed by staining with 50 nM LysoTracker™ Deep Red ...
-
bioRxiv - Neuroscience 2021Quote: ... The antibodies were rat anti-BrdU (1:500, MCA2060, Bio-Rad) or rabbit anti-GFAP (1:300 ...
-
bioRxiv - Immunology 2021Quote: ... rat anti-mouse CD68 (1:100, #MCA1957GA, Bio-Rad, Puchheim, Germany), hamster anti-mouse CD3e (1:100 ...
-
bioRxiv - Developmental Biology 2021Quote: ... Immunohistochemistry was performed using rat anti-BrdU (MCA2060 GA, Bio-Rad), rabbit anti-Sp7/Osx (sc-22536-r ...
-
bioRxiv - Bioengineering 2020Quote: ... A FITC-conjugated rat anti-mouse CD204 monoclonal antibody (Bio-Rad) was prepared 1:200 in DMEM or CDMEM ...
-
bioRxiv - Bioengineering 2020Quote: ... Rat Anti-mouse CD68 (Biorad, MCA1957T, 1:200 dilution, 5μg/mL); Rabbit polyclonal anti-Histone-H2B (Abcam ...
-
bioRxiv - Cell Biology 2021Quote: ... 5 μl primary rat anti-tubulin antibody (Bio-Rad AbD Serotec) at a 1:50 dilution in PBS/1%BSA was added and the slide incubated in a dark wet chamber at room temperature for 2 h ...
-
bioRxiv - Neuroscience 2022Quote: ... the primary antibody used was 1:100 CD68 (rat, Bio-Rad), and the secondary antibody was anti-rat Cy3 (Jackson Immunoresearch ...
-
bioRxiv - Immunology 2022Quote: ... rat anti-mouse F4/80 (BioRad, Cat# MCA497R, RRID:AB_323279, 1:50), rabbit anti-mouse Marco (Abcam ...
-
bioRxiv - Molecular Biology 2019Quote: ... and CldU primary antibody (rat anti-BrdU, Biorad OBT0030S; Lot# 0109) or IdU primary antibody (mouse anti-BrdU ...
-
bioRxiv - Physiology 2020Quote: ... Anti F4/80 rat monoclonal (1:100; Bio-Rad, Hercules, CA) for macrophages ...
-
bioRxiv - Microbiology 2020Quote: ... The following antibodies were used: mouse anti-rat CD43 antibody (BioRad), rabbit polyclonal Surfactant C (Proteintech) ...
-
bioRxiv - Neuroscience 2020Quote: ... rat anti-CD68 (1:200; MCA1957GA, Bio-Rad Company, United States), guinea pig anti-DCX (1:300 ...
-
bioRxiv - Cell Biology 2022Quote: ... followed by Goat anti-rat IgG-HRP (1/5000, Bio-Rad), and rabbit α-PkNBPXa (1/5000) ...
-
bioRxiv - Neuroscience 2023Quote: ... rat anti-Sn (1:300, catalog no. MCA947G; Bio-Rad Laboratories), hamster anti-CD11c (1:100 ...
-
bioRxiv - Neuroscience 2023Quote: ... rat anti-CD4 (1:1,000, catalog no. MCA1767; Bio-Rad Laboratories), rat anti-CD8 biotinylated (1:500 ...
-
bioRxiv - Neuroscience 2023Quote: ... rat anti-CD11b (1:100, catalog no. MCA74G; Bio-Rad Laboratories), rabbit anti-CD11b (1:100 ...
-
bioRxiv - Neuroscience 2023Quote: ... rat anti-CD8 (1:500, catalog no. MCA609G; Bio-Rad Laboratories); rabbit anti-MBP (1:300 ...
-
bioRxiv - Neuroscience 2023Quote: ... rat anti-CD11b (1:100, catalog no. MCA74G; Bio-Rad Laboratories); hamster anti- CD11c (1:100 ...
-
bioRxiv - Physiology 2023Quote: ... and rat anti-mouse cd68 (5 µg/mL, MCA1957, Bio-Rad) diluted in PTxwH buffer for 4 days ...
-
bioRxiv - Neuroscience 2023Quote: ... rat anti-CD206 (1:1000; Biorad, Hercules, CA, Catalog no. MCA2235GA), rat anti-Ki67 (1:500 ...
-
bioRxiv - Cell Biology 2023Quote: ... and rat anti-α-tubulin (1:2,000, MCA77G, Bio-Rad; RRID:AB_325003). The following secondary antibodies were used at a 1:400 dilution ...
-
bioRxiv - Neuroscience 2024Quote: ... Primary antibodies included rat-anti-CD13 (1:250, Bio-Rad; MCA2183EL), goat anti-CD31 (1:200 ...
-
bioRxiv - Immunology 2024Quote: ... Anti-F4/80 (rat anti-mouse MCA497A647, Biorad, dilution 1:500) and anti-Parp14 (sc377150 ...
-
bioRxiv - Cell Biology 2023Quote: ... for 3 hours followed by 20 μM Nigericin for 3 hours (ICT9146, Bio-Rad).
-
bioRxiv - Cancer Biology 2021Quote: ... 3 µg of total RNA was used in the reverse transcription reaction using the iScript cDNA synthesis kit (Bio-Rad). Quantitative PCR amplification was performed on the Prism 7900 Sequence Detection System (Applied Biosystems ...
-
bioRxiv - Cancer Biology 2021Quote: ... 3 μg of total RNA was used in the reverse transcription reaction using the iScript cDNA synthesis kit (Bio-Rad). Quantitative PCR amplification was performed on the Prism 7900 Sequence Detection System (Applied Biosystems ...
-
bioRxiv - Microbiology 2022Quote: The secretome samples were fractionated by one-dimensional SDS-PAGE with the Mini-protean® 3 kit (Bio-Rad, USA) using a 12% resolving gel and a 5% stacking gel at 200 V for 45 min ...
-
bioRxiv - Cancer Biology 2024Quote: ... 3 μg of total RNA was used in the reverse transcription reaction using the iScript cDNA synthesis kit (Bio-Rad). Quantitative PCR amplification was performed on the Prism 7900 Sequence Detection System (Applied Biosystems ...
-
bioRxiv - Genomics 2019Quote: ... media were collected for insulin determination and rat islet cells were lysed with acid-ethanol (0.2 mM HCl in 75% ethanol) to extract total insulin content or with protein lysis buffer to measure total protein content (Bradford, BioRad). The amount of insulin released in the medium and remaining in the cells was measured by insulin Elisa kit (Mercodia) ...
-
bioRxiv - Cell Biology 2020Quote: ... and rat an α-tubulin (1:1000; MCA78G; Bio-Rad AbD Serotec), polyclonal rabbit lamin B1 (1:300 ...
-
bioRxiv - Immunology 2021Quote: ... slides were incubated in PBS with rat anti-CD8 (Bio-Rad, YTC182.20) plus either rabbit polyclonal anti-SARS-CoV-2 Spike/RBD (Sino ...
-
bioRxiv - Pathology 2022Quote: ... and rat monoclonal anti-F4/80 antibody (Bio-Rad Laboratories, Inc., MCA497GA). Vectastain ABC kit (Vector Laboratories ...
-
bioRxiv - Molecular Biology 2020Quote: ... and Tub1 (rat monoclonal anti-tubulin alpha, (Bio-Rad Cat# MCA77G, RRID:AB_325003)) (1:10000 dilution each in PBS-T) ...
-
bioRxiv - Neuroscience 2021Quote: ... the rat anti-mouse anti-IFN-γ antibody (Bio-Rad, Oxford, UK) and tyrphostin A47 (a tyrosine protein kinase [TPK] specific blocker ...
-
bioRxiv - Neuroscience 2020Quote: ... rat anti-Myelin Basic Protein (BIO-RAD, reference MCA409S, 1/1000 dilution), rabbit anti-β-Tubulin III (Tuj1 ...
-
bioRxiv - Neuroscience 2022Quote: ... rat anti-CD68 (1:2,000, Bio-Rad, Hercules, CA; catalog no. MCA1957), rat anti-Lamp1 (1:4,000 ...
-
bioRxiv - Neuroscience 2023Quote: ... Following primary antibodies were used: anti-CD68 (rat 1:600, BioRad, MCA1957T), anti-Galactin1 (rabbit 1:200 ...
-
bioRxiv - Neuroscience 2023Quote: ... Sections were labeled with rat anti-CD68 (1:400, Bio-Rad MCA1957) or rat anti-MBP (1:500 ...
-
bioRxiv - Neuroscience 2023Quote: ... rat monoclonal anti CD68 (clone FA-11, 1.4 ug/ml, Bio-Rad), rabbit polyclonal anti Iba-1 (1:1000 ...
-
bioRxiv - Molecular Biology 2024Quote: ... and a rat anti-F4/80 antibody (1/300, Bio-Rad, MCA497) to check astrocytic and microglial populations ...
-
bioRxiv - Cell Biology 2024Quote: ... Rat anti-F4/80 (Bio-Rad, clone CI:A3-1, #MCA497GA, 1:50), Rabbit anti-CD45 (Abcam ...
-
bioRxiv - Cell Biology 2024Quote: ... and rat anti-α tubulin (YL1/2) (MCA77G, Bio-Rad; 1:1500). Secondary antibodies used were Alexa Fluor 488 goat anti-mouse IgG (H + L ...
-
bioRxiv - Cell Biology 2020Quote: ... and detected using the antibodies listed in Supplementary File 3 with either SuperSignal West Dura or SuperSignal Femto kits (Pierce, Waltham, MA) and a ChemiDoc XRS imaging system (Bio-Rad). Band intensities were quantified using ImageLab software (Bio-Rad ...