Labshake search
Citations for Bio-Rad :
151 - 200 of 404 citations for IL 7 Human HEK293 His since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2024Quote: ... and heated at 95°C for 7 min prior to separation by 10% SDS-PAGE (BioRad Laboratories). Following electrophoresis ...
-
bioRxiv - Biochemistry 2020Quote: ... Membranes were probed for 1 hour at room temperature with 1:500 anti-XLF(New England Peptides, details in Methods under Immunodepletion) or 1:1000 anti-His (Bio-Rad MCA1396A) in PBST with 2.5% BSA ...
-
bioRxiv - Pathology 2019Quote: ... Affi-gel 10 affinity resins were covalently cross-linked to his-tagged GT198 protein as antigen for affinity purification of anti-GT198 according to the manufacturer’s protocol (Bio-Rad, Hercules, CA). FFPE tumor sections or tumor microarrays were deparaffinized and dehydrated through xylene and ethanol series ...
-
bioRxiv - Genomics 2021Quote: ... The proteins were separated in the first dimension on 4-7 and 5-8 IPG strips (Bio-Rad). The strips were then loaded onto 8-20% gradient PAGE for separation on the second dimension ...
-
bioRxiv - Cell Biology 2020Quote: ... and the slices were transfected at 4 – 7 days in vitro using a Helios gene gun (Bio-Rad). Slices were examined at 1 – 2 weeks post-transfection.
-
bioRxiv - Cancer Biology 2020Quote: ... The plate was run on an ABI ViiA 7 instrument and analyzed with CFX manager software (Bio-Rad).
-
bioRxiv - Biochemistry 2021Quote: ... immobilized pH gradient (IPG) strips of 18 cm having a pH range 4-7 (Ready Strips, Bio-Rad) were used and were rehydrated overnight at RT ...
-
bioRxiv - Cell Biology 2022Quote: ... pH 7) and Western blotting samples were prepared by adding sample buffer (3× Laemmli Sample Buffer 1610747; BioRad) plus 3.57 M β-mercaptoethanol (2-mercaptoethanol ...
-
bioRxiv - Neuroscience 2023Quote: ... and transferred onto nitrocellulose at 25 V for 7 min using the Trans-blot Turbo system (Bio-Rad). Blotting efficiency was visualized by red Ponceau staining on membranes ...
-
bioRxiv - Biochemistry 2023Quote: ... and transferred at 1.3 A/25 V for 7 min using the Trans-Blot Turbo system (Bio-Rad). Afterwards ...
-
bioRxiv - Molecular Biology 2020Quote: ... goat anti-human IgG Fc (Biorad; 5211-8004; 1:2000) and rabbit anti-Vinculin (EPR8185 ...
-
bioRxiv - Microbiology 2021Quote: ... the Pro™ Human Cytokine 27-plex Assay (Bio-Rad) was used according to the manufacturer’s protocol and read on a Bio-Plex 3D suspension array system including a Bio-Plex Manager software v 6.0 (Bio-Rad).
-
bioRxiv - Developmental Biology 2022Quote: ... or anti-Human IgG Kappa (STAR 127, Bio-Rad, USA) control antibody
-
bioRxiv - Microbiology 2022Quote: ... and HRP-conjugated goat anti-human IgG (BioRad #172-1050) were used as secondary antibodies for ELISA and western blot assays.
-
bioRxiv - Immunology 2019Quote: ... or RasGRP1 (PrimePCR SYBR Green Assay RasGRP1 human, Bio-Rad, amplicon context sequence GGTTCCTTGGTTCCCGGGCATAGGAAAGCTCATAGATTTCATCCTCAGTGTAGTAAAGAT CCAGGGATAACGTCAGCAAGTGTACCAAGTCCTTGTTAGCCTCCAAGG (exon 10) ...
-
bioRxiv - Cancer Biology 2021Quote: ... Bio-Plex Pro Human Cytokine ICAM-1 (BioRad, USA; 171B6009M) and Bio-Plex Pro Human Cytokine VCAM-1 (BioRad ...
-
bioRxiv - Molecular Biology 2022Quote: ... goat anti-human IgG F(ab’)2 (STAR126, Bio-Rad), anti-M13-pVIII-HRP (Cytiva 27-9421-01 ...
-
bioRxiv - Immunology 2023Quote: ... goat anti-human– horseradish peroxidase (HRP) secondary antibody (Bio-Rad) at a 1:3,000 dilution was applied for 1 h at 4°C ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Mouse monoclonal anti-Human Vinculin (V284) antibody (Bio-Rad, MCA465GA), 1:1,000 ...
-
bioRxiv - Cell Biology 2020Quote: ... The blot was then incubated with HRP-conjugated anti-His monoclonal antibody (1:5000) and detected with supersignalfemto substrate (Thermoscientific, USA) using ChemiDoc imaging system (Bio-Rad laboratories, USA).
-
bioRxiv - Biochemistry 2022Quote: ... acidified to pH3–4 by adding appropriate amount of TFA and subjected to HPLC purification using a C4 reverse-phase column (Hi-Pore reversed-phase column, 4.6 × 250 mm, Bio-Rad, Hercules, CA, USA). The S-sulfonated FAM237A was eluted from the C4 reverse-phase column by an acidic acetonitrile gradient composed of the acidic solvent A (0.1% aqueous TFA ...
-
bioRxiv - Biochemistry 2023Quote: ... and the S-sulfonated FAM237B was eluted from a C4 reverse-phase column (Hi-Pore reversed-phase column, 4.6 × 250 mm, Bio-Rad, Hercules, CA, USA) by an acidic acetonitrile gradient ...
-
bioRxiv - Microbiology 2024Quote: ... and HopAM1 and C-terminal Flag-tagged IpaH4 were generated by PCR amplification using primers containing Flag sequences and flanking SacII / PacI off pIB/V5-His templates using iProof DNA polymerase (Bio-Rad; Table S4) and cloned into the pDGOpIE2 vector ...
-
bioRxiv - Microbiology 2021Quote: ... a 96-well plate was loaded into the QX200 Auto DG to generate droplets (Bio-Rad, IL USA) in each well ...
-
bioRxiv - Microbiology 2020Quote: ... vascular endothelial growth factor (VEGF) and IL-18 were measured on a Bio-Plex 200 instrument (Bio-Rad) using the Non-Human Primate Cytokine MILLIPLEX map 23-plex kit (Millipore ...
-
Bat influenza vectored NS1-truncated live vaccine protects pigs against heterologous virus challengebioRxiv - Microbiology 2020Quote: ... The membrane was incubated with a primary mouse anti-pig IL-18 antibody (diluted 1:500, Bio-Rad) or anti-β-actin antibody (diluted 1:500 ...
-
bioRxiv - Developmental Biology 2021Quote: ... was performed in 7 min at 1.3 A and 25 V using a Trans-Blot TurboTM transfer system (BioRad). Recognition and revelation of the his-tagged protein was performed as described for the Dot Blot ...
-
bioRxiv - Neuroscience 2019Quote: ... “any kD” (to quantify GDNF protein) or 7% (to quantify CBP) precast polyacrylamide gel (Bio-rad, Hercules, Cal, USA) and transferred to a polyvinylidene difluoride membrane (PVDF ...
-
bioRxiv - Microbiology 2020Quote: ... in 0.5×TBE buffer at 4 to 7 °C for 260 h using a CHEF Mapper System (Bio-Rad). Switching time was 1,200 to 4,800 s at 1.5 V/cm with an included angle of 120° ...
-
bioRxiv - Molecular Biology 2022Quote: ... LarA extracted from a 7 cm prep well Mini-PROTEAN® TGX Stain-Free™ gel (#4568091, Bio-Rad) was used for affinity purification of the final antibody.
-
bioRxiv - Synthetic Biology 2022Quote: ... The reaction was run for 7 h at 34 °C on a CFX96 real-time PCR detection system (Biorad) and monitored thanks to the SYBR Green II signal.
-
bioRxiv - Biochemistry 2023Quote: ... The gels were then transferred to a water-activated nitrocellulose membrane at 1.3A to 25V for 7 minutes (BioRad TurboBlotter ...
-
bioRxiv - Microbiology 2023Quote: ... for 7 min at 2.5A and 12V using a Trans-Blot® Turbo™ Transfer System (Bio-Rad #1704150EDU). Membranes were saturated in PBS (137 mM NaCl ...
-
bioRxiv - Cell Biology 2023Quote: ... Proteins were separated on 15% SDS-PAGE and were transferred to PVDF membrane under 2.5A/25V condition for 7 min using a semidry transfer system (Trans-Blot Turbo, BioRad). Transferred membranes were first blocked by TBS-Tween20 (0.1% ...
-
bioRxiv - Immunology 2024Quote: ... was introduced by electroporation (7 square wave pulses of 30 V, 3ms, 0,1s pause) using a GenePulser Xcell electroporator (Biorad) and a 1 mm cuvette (Biorad) ...
-
bioRxiv - Synthetic Biology 2024Quote: ... followed by incubation at 37 °C for up to 7 hours on a real-time qPCR instrument (Biorad, CFX96). To measure the time-dependent change in fluorescence ...
-
bioRxiv - Microbiology 2024Quote: ... supplemented with 2% w/v CA and treated with (7% w/v) Chelex100 resin (Bio-Rad, Mississauga, ON, Canada) at 4°C overnight ...
-
bioRxiv - Microbiology 2022Quote: ... from 22 people were quantified using a Bio-Plex Pro™ Human Inflammation 24-Plex Panel or a Bio-Plex Pro™ Human Th17 Cytokine Panel 15-Plex Panel (Bio-Rad, Hercules, CA, USA). Cytokines were omitted from further analyses if their concentration was close to the lower limit of detection in most samples ...
-
bioRxiv - Biochemistry 2021Quote: ... Human primers were designed by using Beacon Designer software (Bio-Rad). Quantitative PCR was performed on a CFX96 real-time PCR thermocycler (Bio-Rad ...
-
bioRxiv - Immunology 2019Quote: The following antibodies were used: anti-human CD53 (MEM-53, Biorad), anti-human CD53-488 (MEM-53 ...
-
bioRxiv - Cancer Biology 2021Quote: ... and Bio-Plex Pro Human Cytokine VCAM-1 (BioRad, USA; 171B6022M) were used ...
-
bioRxiv - Immunology 2020Quote: Human CTL were transfected using a GenePulser Xcell electroporation system (BioRad). 1x106 CTL (5days after restimulation therefore in expansion phase ...
-
bioRxiv - Pathology 2023Quote: ... or mouse monoclonal antibodies against human C3d (Bio-Rad Laboratories, CA) and C4d (Santa Cruz ...
-
bioRxiv - Neuroscience 2024Quote: ... Primers/probes to detect human RPP30 (BioRad Custom Assay, Hercules, CA) were used as an endogenous reference in human samples ...
-
bioRxiv - Developmental Biology 2021Quote: ... Sections were incubated overnight at 4 °C with rabbit anti-chick IL-6 (Bio-Rad Laboratories, Inc., Hercules, CA) diluted 1:20 in incubation buffer ...
-
bioRxiv - Immunology 2023Quote: IL-27 plasma levels were assessed using the Mouse Cytokine 23-Plex immunoassay (Bio-Rad Laboratories, Inc., CA, USA) and by the IL-27 Mouse ELISA kit (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2021Quote: ... DNA samples (3 μl) and master mixes (7 μl) were pipetted into a 96-well PCR plate (Bio-Rad #MLL9651) and PCR amplification performed using the CFX96 Touch Real-Time PCR Detection System (Bio-Rad) ...
-
bioRxiv - Genetics 2021Quote: ... Proteins (7 μl of extract) were separated on Laemmli SDS-PAGE gels and transferred to nitrocellulose membranes (Bio-Rad, 1620112). Membranes were stained with Ponceau-S for visualization ...
-
bioRxiv - Immunology 2021Quote: ... A 2.7 μL aliquot from each sample was mixed with 2.5 μL of SsoFast EvaGreen Supermix with Low Rox (Bio-Rad) and 0.25 μL of Fluidigm’s DNA Binding Dye Sample Loading Reagent in a separate plate and centrifuged to mix solutions ...
-
bioRxiv - Plant Biology 2021Quote: ... Total proteins were separated by electrophoresis in 7% SDS-polyacrylamide gels and electrophoretically transferred to a polyvinylidene fluoride membrane according to the manufacturer’s protocol (Bio-Rad). Transferred proteins were detected with Ponceau-S ...