Labshake search
Citations for Bio-Rad :
151 - 200 of 6666 citations for Human Mitochondrial Genome Maintenance Exonuclease 1 MGME1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2020Quote: ... 1 μg of RNA was reverse transcribed (iScript cDNA Synthesis Kit (BioRad)) and the cDNA was purified with QiaQuick PCR Purification Kit (Qiagen) ...
-
bioRxiv - Systems Biology 2022Quote: ... total RNA (1 μg) was reverse transcribed using the SuperScript kit (BioRad), and the Real-time PCR was performed in three technical replicates using the Applied Biosystems StepOnePlus Real-Time PCR system and Fast SYBR Green Master Mix (Applied Biosystems) ...
-
bioRxiv - Genomics 2023Quote: ... then embedded in 1% low-melt agarose blocks (BioRad Plug Kit #1703591) to preserve DNA integrity ...
-
bioRxiv - Biophysics 2023Quote: ... Single-stranded cDNA was synthesized from 1 µg of total RNA as template using a commercially available kit (iScript cDNA Synthesis Kit, Biorad). RT-qPCR analysis of nascent mRNA abundance was performed in duplicate using iQ SYBR Green Supermix (Biorad #1708880 ...
-
bioRxiv - Molecular Biology 2023Quote: ... One aliquot was used to synthesize single-stranded cDNA starting from 1 µg of total RNA using a commercially available kit (iScript cDNA Synthesis Kit, Biorad).
-
bioRxiv - Microbiology 2021Quote: ... the Pro™ Human Cytokine 27-plex Assay (Bio-Rad) was used according to the manufacturer’s protocol and read on a Bio-Plex 3D suspension array system including a Bio-Plex Manager software v 6.0 (Bio-Rad).
-
bioRxiv - Developmental Biology 2022Quote: ... or anti-Human IgG Kappa (STAR 127, Bio-Rad, USA) control antibody
-
bioRxiv - Microbiology 2022Quote: ... and HRP-conjugated goat anti-human IgG (BioRad #172-1050) were used as secondary antibodies for ELISA and western blot assays.
-
bioRxiv - Immunology 2019Quote: ... or RasGRP1 (PrimePCR SYBR Green Assay RasGRP1 human, Bio-Rad, amplicon context sequence GGTTCCTTGGTTCCCGGGCATAGGAAAGCTCATAGATTTCATCCTCAGTGTAGTAAAGAT CCAGGGATAACGTCAGCAAGTGTACCAAGTCCTTGTTAGCCTCCAAGG (exon 10) ...
-
bioRxiv - Molecular Biology 2022Quote: ... goat anti-human IgG F(ab’)2 (STAR126, Bio-Rad), anti-M13-pVIII-HRP (Cytiva 27-9421-01 ...
-
bioRxiv - Immunology 2023Quote: ... goat anti-human– horseradish peroxidase (HRP) secondary antibody (Bio-Rad) at a 1:3,000 dilution was applied for 1 h at 4°C ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Mouse monoclonal anti-Human Vinculin (V284) antibody (Bio-Rad, MCA465GA), 1:1,000 ...
-
bioRxiv - Immunology 2020Quote: Staining of 2×105 cells per well was performed with mouse anti-human CD79α (clone HM57, Bio-Rad AbD Serotec, Puchheim, Germany, 1:100) for identification of B cells and Alexa Fluor 647-conjugated rat anti-human CD3∊ (clone CD3-12 ...
-
bioRxiv - Neuroscience 2024Quote: ... and the absorbance value of each well was measured at a wavelength of 450 nm on microplate ELISA reader (Microplate Manager v5.2.1 software, Bio-Rad Laboratories).
-
bioRxiv - Cell Biology 2020Quote: ... and cDNA was reversely transcribed with 0.5–1 μg RNA using the iScript cDNA synthesis kit as described in the kit (Biorad, Hercules, CA). The gene expression of Il-6 ...
-
bioRxiv - Immunology 2019Quote: ... 1 µg of RNA was reverse transcribed using iScript cDNA synthesis kit (BioRad) and the resulting cDNA was diluted 1/10 for the qPCR ...
-
bioRxiv - Microbiology 2019Quote: ... and 1 mM sodium vanadate and equilibrated for protein content (Biorad assay kit). All lysates were resolved by SDS-PAGE electrophoresis and transferred to PVDF membranes ...
-
bioRxiv - Cancer Biology 2020Quote: ... and 1 µg reversely transcribed into cDNA (iScript cDNA synthesis kit, Bio-Rad). Gene expression was assessed from 10 ng cDNA at the ABI 7900 HT system using SYBR green detection and the SDS (v2.4 ...
-
bioRxiv - Cell Biology 2022Quote: ... in PBS and incubated overnight at 4°C in primary antibodies: anti-human actin-β primary monoclonal antibody produced in mouse (1:100; Bio-Rad Laboratories Inc. MCA57766A) and non-muscle myosin II produced in rabbit (1:100 ...
-
bioRxiv - Microbiology 2022Quote: ... from 22 people were quantified using a Bio-Plex Pro™ Human Inflammation 24-Plex Panel or a Bio-Plex Pro™ Human Th17 Cytokine Panel 15-Plex Panel (Bio-Rad, Hercules, CA, USA). Cytokines were omitted from further analyses if their concentration was close to the lower limit of detection in most samples ...
-
bioRxiv - Immunology 2021Quote: ... TMB substrate was added to stop the reaction before performing the reading at 450 nm in the ELISA plate reader (iMark Microplate Reader, Bio-Rad).
-
bioRxiv - Biochemistry 2021Quote: ... Human primers were designed by using Beacon Designer software (Bio-Rad). Quantitative PCR was performed on a CFX96 real-time PCR thermocycler (Bio-Rad ...
-
bioRxiv - Immunology 2019Quote: The following antibodies were used: anti-human CD53 (MEM-53, Biorad), anti-human CD53-488 (MEM-53 ...
-
bioRxiv - Immunology 2020Quote: Human CTL were transfected using a GenePulser Xcell electroporation system (BioRad). 1x106 CTL (5days after restimulation therefore in expansion phase ...
-
bioRxiv - Pathology 2023Quote: ... or mouse monoclonal antibodies against human C3d (Bio-Rad Laboratories, CA) and C4d (Santa Cruz ...
-
bioRxiv - Neuroscience 2024Quote: ... Primers/probes to detect human RPP30 (BioRad Custom Assay, Hercules, CA) were used as an endogenous reference in human samples ...
-
bioRxiv - Pathology 2019Quote: ... and 1 µg of RNA was transcribed into cDNA using the iScript Kit (BioRad). The cDNA was then diluted 10x with water and 2 µl was mixed with iQ SYBR Green Supermix (BioRad ...
-
bioRxiv - Cancer Biology 2021Quote: ... Complementary DNA (cDNA) was synthesised from 1 µg RNA using an iScript kit (BioRad). DNA was diluted to 10 ng/µland 2 µl was used in each RT-qPCR reaction with 10 µl iTAQ Universal SYBR green supermix (BioRad ...
-
bioRxiv - Physiology 2019Quote: ... 1 μg RNA was reverse transcribed using IScriptTM cDNA synthesis kit (Biorad, Hercules, CA). RT-PCR was performed with the ViiaTM 7 Real-Time PCR System (Life Technologies ...
-
bioRxiv - Plant Biology 2019Quote: ... 1 µg of RNA was reverse-transcribed using the IScript cDNA synthesis kit (BioRad) or Superscript IV RT (Invitrogen) ...
-
bioRxiv - Microbiology 2021Quote: ... RNA (1 mg total) was reverse transcribed using iScript cDNA Synthesis Kit (Bio-Rad) and diluted to 100 μl in ddH20 for subsequent qPCR ...
-
bioRxiv - Neuroscience 2023Quote: ... 1 μg of RNA was converted to cDNA using iScript cDNA Synthesis kit (BioRad) according to manufacturer’s instructions and diluted 1:100 in water ...
-
bioRxiv - Developmental Biology 2023Quote: ... RNA (1 μg) was reverse transcribed using the iScript cDNA Synthesis kit (BioRad 1708890). mRNA expression was detected using the Fast Start Essential Green DNA master mix (Roche 06924204001 ...
-
bioRxiv - Cell Biology 2024Quote: ... RNA (1 μg) was reverse transcribed using iScript™ cDNA Synthesis Kit (Bio-Rad), and PCR was performed using Q5® High-Fidelity 2X Master Mix (NEB) ...
-
bioRxiv - Cancer Biology 2023Quote: ... and 1 μg was reverse transcribed using the iScript cDNA Synthesis kit (Bio-Rad). Real-time quantitative RT– PCR was performed on a LightCycler 2.0 apparatus (Roche ...
-
bioRxiv - Zoology 2021Quote: The quantitative determination of IFN-ɣ in buffalo serum was assayed by a commercial bovine IFN gamma sandwich ELISA test (Bio-Rad) following the manufacture’s specifications ...
-
bioRxiv - Immunology 2020Quote: ... RBD-specific antibody titres in oral and nasal swab fluids were determined by ELISA as detailed above except that the conjugated secondary antibody was replaced with either goat anti-porcine IgG HRP (Bio-Rad Antibodies) at 1:20,000 dilution in PBS with 1% (w/v ...
-
bioRxiv - Immunology 2022Quote: ... Pre-designed human gene primers were purchased from Bio-Rad (supplemental Table). Human PPIA was amplified in parallel and used as the reference gene in quantification ...
-
bioRxiv - Biochemistry 2020Quote: ... with goat anti-human IgG F(ab’)2-HRP (STAR126P, Bio-Rad) as the detection antibody.
-
bioRxiv - Biophysics 2020Quote: ... and mouse anti-human CD34 (QBEND 10 clone, Ms IgG1, Bio-Rad). Briefly ...
-
bioRxiv - Cancer Biology 2022Quote: ... Human primers for HLA-DRB1 and VCAM1 were purchased from Bio-Rad.
-
bioRxiv - Cancer Biology 2021Quote: ... and resuspended in FACS buffer with Fc-block (Human Seroblock, Bio-Rad). These samples were then re-pelleted and suspended in a cocktail of fluorophore-conjugated primary antibodies (Supp ...
-
bioRxiv - Immunology 2020Quote: ... and incubated with either FITC-conjugated Sheep Anti-Human C3 (BioRad AHP031F) at 1:500 or AF488-conjugated Mouse Anti-C5b-9 (ae11 ...
-
bioRxiv - Cancer Biology 2023Quote: ... and G-CSF quantification using a human Bio-plex PRO assay (Biorad) following the manufacturer’s instructions and acquired with the Luminex200 instrument (Luminex).
-
bioRxiv - Immunology 2023Quote: ... A human RPP30 copy number assay labeled with HEX (Bio-Rad, dHsaCP1000485) was used to measure total allelic copy numbers ...
-
bioRxiv - Immunology 2023Quote: ... with human IgA positive and negative controls (Bio-Rad, Cat No. 12014775), Bio-Plex SARS-CoV-2 Wuhan-1 strain RBD and N coupled beads (Bio-Rad ...
-
bioRxiv - Physiology 2023Quote: Human recombinant monoclonal antibodies to mouse ERFE were produced by Bio-Rad using HuCAL technology ...
-
bioRxiv - Physiology 2023Quote: Human recombinant monoclonal antibodies to mouse ERFE were produced by Bio-rad using the HuCAL technology ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... Absorption was read at 450 nm with wavelength correction set to 540 nm using an ELISA plate reader (Bio-Rad, Hercules, CA, USA). Intra- and inter-assay coefficients of variation were <10% for all EIAs.
-
bioRxiv - Molecular Biology 2021Quote: ... The plates were incubated at 37°C for different time points (0,4hr,12hr,24hr,72hr) and was measured on an ELISA reader (Bio-Rad, Hercules, CA, USA) at a wavelength of 570 nm and O.D was recorded.