Labshake search
Citations for Bio-Rad :
151 - 200 of 4270 citations for Human Gastrin Cholecystokinin Type B Receptor CCKBR ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: ... Levels of the following 27 cytokines were analyzed using a BioPlex Pro™ Human Cytokine 27-plex Assay kit (#M500KCAF0Y, Bio-Rad, Hercules, CA, USA) in accordance with the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2020Quote: Levels of PAI1 in human plasma were measured using a Bio-Plex multiplex enzyme immunoassay (Customized Human Cancer Biomarker Assay, Bio-Rad Laboratories). Plasma was diluted 1:4 in assay diluent prior to performing the assay ...
-
bioRxiv - Biochemistry 2023Quote: ... The culture medium after incubation was analyzed for the presence of secreted human cytokines using Bio-Plex Pro Human Cytokine 17-plex Assay (Bio-Rad, USA) and Bio-Plex 200 Systems (Bio-Rad ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... Samples were then run on either 4-15% (a) or 8-16% (b) precast gels (Biorad), transferred onto 0.1μm nitrocellulose membranes and used for immunoblot detection ...
-
bioRxiv - Physiology 2019Quote: ... After loading wells were sealed with Microseal® ‘B’ seal (Bio-Rad Laboratories, the United Kingdom) avoiding that air bubbles ...
-
bioRxiv - Immunology 2020Quote: cDNA was generated from sorted B cells by adding 4µl of iScript (Bio-Rad Cat# 1708891) and cycling according to the manufacturer’s instructions ...
-
bioRxiv - Physiology 2023Quote: ... cDNA synthesis from RNA was completed using 5x iScript RT Supermix (Bio-Rad, Catalog #L001404 B) according to the manufacturer’s protocol ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: Single antigen-binding B cells were sorted using an S3 cell sorter (Bio-Rad, Hercules, CA), and deposited into a PCR tube with 5 μL lysis buffer (Takara Bio ...
-
bioRxiv - Biochemistry 2024Quote: ... 2) Arm B was purified on an ENrich™ SEC 650 24 mL column (Bio-Rad), and 3 ...
-
bioRxiv - Immunology 2021Quote: ... Conjugates against anti-human IgG-HRP (BioRad, Richmond, CA) or anti-human IgA-HRP (Nordic BioSite ...
-
bioRxiv - Cancer Biology 2020Quote: ... with certified human GAPDH and LOX primers (Bio-Rad). The reaction was run in CFX Connect 96 Real Time PCR system (Bio-Rad) ...
-
bioRxiv - Cancer Biology 2021Quote: ... Bio-Plex Pro Total Human GAPDH (BioRad, USA, 171V60019M), Bio-Plex Pro Total β-Actin (BioRad ...
-
bioRxiv - Molecular Biology 2022Quote: ... 1× AP3B1-HEX-labelled human reference assay (dHsaCP1000001, BioRAD), 1/40 HindIII (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2022Quote: ... 1× AP3B1-HEX labelled human reference assay (Bio-Rad), 1/40 HaeIII (Invitrogen ...
-
bioRxiv - Microbiology 2023Quote: ... Goat F(ab)2 anti-human IgG: HRP (Biorad), Goat anti-mouse IgG (H/L) ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... human cytokine 17 and 27-plex from Bio-Rad, (NSW ...
-
bioRxiv - Immunology 2020Quote: ... IL-23 was measured using either a mouse IL-23 ELISA (R&D) or Luminex based method from BioRad. IL-12p40 ...
-
bioRxiv - Immunology 2020Quote: ... followed by measuring the absorbance of individual wells at 450 nm using an ELISA reader (Bio-rad mod.550). Serum samples from unmanipualted mice were used for negative controls.
-
bioRxiv - Physiology 2021Quote: ... RNA was transferred onto a nylon membrane (Hybond-N; Biodyne B) using Trans-Blot Turbo (Bio-Rad) at 25 V for 30 min ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Reactions were performed using a 96 well plate with an optically clear microseal ‘B’ film (Bio-Rad). Three technical replicate reactions were performed for each biological replicate ...
-
bioRxiv - Molecular Biology 2020Quote: ... goat anti-human IgG Fc (Biorad; 5211-8004; 1:2000) and rabbit anti-Vinculin (EPR8185 ...
-
bioRxiv - Microbiology 2021Quote: ... the Pro™ Human Cytokine 27-plex Assay (Bio-Rad) was used according to the manufacturer’s protocol and read on a Bio-Plex 3D suspension array system including a Bio-Plex Manager software v 6.0 (Bio-Rad).
-
bioRxiv - Developmental Biology 2022Quote: ... or anti-Human IgG Kappa (STAR 127, Bio-Rad, USA) control antibody
-
bioRxiv - Microbiology 2022Quote: ... and HRP-conjugated goat anti-human IgG (BioRad #172-1050) were used as secondary antibodies for ELISA and western blot assays.
-
bioRxiv - Immunology 2019Quote: ... or RasGRP1 (PrimePCR SYBR Green Assay RasGRP1 human, Bio-Rad, amplicon context sequence GGTTCCTTGGTTCCCGGGCATAGGAAAGCTCATAGATTTCATCCTCAGTGTAGTAAAGAT CCAGGGATAACGTCAGCAAGTGTACCAAGTCCTTGTTAGCCTCCAAGG (exon 10) ...
-
bioRxiv - Cancer Biology 2021Quote: ... Bio-Plex Pro Human Cytokine ICAM-1 (BioRad, USA; 171B6009M) and Bio-Plex Pro Human Cytokine VCAM-1 (BioRad ...
-
bioRxiv - Molecular Biology 2022Quote: ... goat anti-human IgG F(ab’)2 (STAR126, Bio-Rad), anti-M13-pVIII-HRP (Cytiva 27-9421-01 ...
-
bioRxiv - Immunology 2023Quote: ... goat anti-human– horseradish peroxidase (HRP) secondary antibody (Bio-Rad) at a 1:3,000 dilution was applied for 1 h at 4°C ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Mouse monoclonal anti-Human Vinculin (V284) antibody (Bio-Rad, MCA465GA), 1:1,000 ...
-
bioRxiv - Plant Biology 2020Quote: ... PCR was performed in 0.5 ml eppendorf-type microcentrifuge tubes on an iCycler (Bio-Rad, Hercules, CA, USA) or Dyad (Bio-Rad ...
-
bioRxiv - Biochemistry 2023Quote: ... The sample was passed twice on 2 x Mini CHT ™ type I column (Bio-Rad, United States). Elution was performed with a gradient of 0 to 200 mM NaPO42- in 10 min ...
-
bioRxiv - Microbiology 2019Quote: ... Serum was collected at day 49 and anti-M1 titers were measured by ELISA as previously described72 with a goat anti-mouse HRP-conjugated secondary antibody at 1:5000 (BioRad). Immunized and control mice were infected subcutaneously into the flank with 2×107 cfu of the AP1 (n=17 ...
-
bioRxiv - Neuroscience 2024Quote: ... and the absorbance value of each well was measured at a wavelength of 450 nm on microplate ELISA reader (Microplate Manager v5.2.1 software, Bio-Rad Laboratories).
-
bioRxiv - Neuroscience 2021Quote: ... Samples were then measured to 20μg total protein in 2x Laemmli buffer containing 10% b-mercaptoethanol (Bio-rad), heated at 70°C for 10min and loaded into 4-20% precast gels (Bio-rad ...
-
bioRxiv - Molecular Biology 2020Quote: ... After 2 weeks cells were stained by the sulforhodamine B and photographed by E-Gel Imager (Bio-Rad). The cloning numbers in each group were counted to calculate the inhibition rate.
-
bioRxiv - Immunology 2019Quote: ... Endotoxin was removed by passing over two polymyxin-B columns (Affi-Prep Polymyxin Resin; Bio-Rad, Hercules, CA). Additionally ...
-
bioRxiv - Biochemistry 2021Quote: ... in thin-walled 96-well PCR plates with transparent Microseal® ‘B’ seals (Bio-Rad, Hercules, California, USA). The temperature ramp was between 25 °C and 94 °C with a 0.5 °C increase per cycle for 140 cycles and a cycle duration of 30 seconds ...
-
bioRxiv - Plant Biology 2021Quote: ... The membrane was incubated with an anti-cardosin B antibody (Antibody generated by HuCAL technology, Bio-Rad, USA) as described in 16 diluted in PBS-T (0.4 μg/ml ...
-
bioRxiv - Immunology 2023Quote: ... primary B cells were activated as above and then lysed with 4X Laemmli buffer with beta-mercaptoethanol (BioRad) to a final concentration of 1X ...
-
bioRxiv - Physiology 2023Quote: ... Individual cDNA samples were run in duplicate using iTaq Universal SYBR Green Supermix (Bio-Rad, Catalog #L001752 B), with a final volume in each well equal to 15uL ...
-
bioRxiv - Biophysics 2023Quote: ... Plates were sealed with a quantitative PCR adhesive optical seal sheet (Microseal ‘B’ Adhesive Sealing Films, BIO-RAD) and then spun at 1000 rpm for 1 min to remove bubbles ...
-
bioRxiv - Microbiology 2022Quote: ... from 22 people were quantified using a Bio-Plex Pro™ Human Inflammation 24-Plex Panel or a Bio-Plex Pro™ Human Th17 Cytokine Panel 15-Plex Panel (Bio-Rad, Hercules, CA, USA). Cytokines were omitted from further analyses if their concentration was close to the lower limit of detection in most samples ...
-
bioRxiv - Biophysics 2020Quote: ... Protein concentrations were determined using unlabeled wild-type proteins (β or PCNA) as standards in a Bradford assay (BioRad). Fluorophorophore concentrations were determined from absorbance measurements and molar absorptivities as described previously (9,10).
-
bioRxiv - Biophysics 2019Quote: ... The retention time of both oligomer types was compared with a set of molecular weight protein standards (Bio-Rad) consisting of bovine serum albumin (66.5 kDa) ...
-
bioRxiv - Biochemistry 2021Quote: ... Transcriptionally active Q0.3 fraction (0.32–0.4 M) were pooled and applied directly to hydroxyapatite (HAP) type II ceramic resin (Bio-Rad), washed first at 0.38 M ...
-
bioRxiv - Immunology 2021Quote: ... TMB substrate was added to stop the reaction before performing the reading at 450 nm in the ELISA plate reader (iMark Microplate Reader, Bio-Rad).
-
bioRxiv - Biochemistry 2021Quote: ... Human primers were designed by using Beacon Designer software (Bio-Rad). Quantitative PCR was performed on a CFX96 real-time PCR thermocycler (Bio-Rad ...
-
bioRxiv - Immunology 2019Quote: The following antibodies were used: anti-human CD53 (MEM-53, Biorad), anti-human CD53-488 (MEM-53 ...
-
bioRxiv - Cancer Biology 2021Quote: ... and Bio-Plex Pro Human Cytokine VCAM-1 (BioRad, USA; 171B6022M) were used ...
-
bioRxiv - Immunology 2020Quote: Human CTL were transfected using a GenePulser Xcell electroporation system (BioRad). 1x106 CTL (5days after restimulation therefore in expansion phase ...