Labshake search
Citations for Bio-Rad :
151 - 200 of 1214 citations for 7 chlorobenzo b thiophen 3 2H one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Pathology 2024Quote: ... Images were analyzed with Quantity One software (Bio-Rad).
-
bioRxiv - Neuroscience 2021Quote: ... was used from each sample for One-step reverse transcriptase quantitative polymerase chain reaction (RT-qPCR) using the iTaq™ Universal SYBR® Green One-Step kit (Bio-Rad) in the StepOnePlus™ Real Time PCR system (Applied Biosystems) ...
-
bioRxiv - Microbiology 2021Quote: ... for 7 min in a Trans-Blot Turbo Transfer System (BioRad). Membranes were blocked with 3% BSA in TBST and incubated with mouse anti-His monoclonal antibody overnight in a cold room ...
-
bioRxiv - Cell Biology 2019Quote: ... and droplet generation oil (Bio-rad, 1864006; 7 ml per run), were connected to a microfluidics device (FlowJEM ...
-
bioRxiv - Immunology 2021Quote: ... and mouse anti-pig CD203a-FITC (clone PM18-7; Bio-Rad). Granulocytes were defined as 2B2+CD203a- ...
-
bioRxiv - Cancer Biology 2022Quote: ... Proteins were then transferred to a Minisize PVDF 7 membrane (BioRad) using a semi-dry transfer (TurboBlot ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... PV1s (7 μg) and molecular weight marker (Dual Color, Bio-Rad) were transferred from SDS-PAGE 16% gels onto nitrocellulose membranes (Amersham ...
-
bioRxiv - Cancer Biology 2019Quote: ... Immunohistochemistry for Sdc1 (1:50 dilution of B-A38, Bio-Rad) was performed by the VCU Cancer Mouse Models Core Laboratory with the Leica Bond RX auto-stainer using heat-induced epitope retrieval buffer 1 (Leica ...
-
bioRxiv - Microbiology 2020Quote: ... influenza type b serogroup-specific antisera (Bio-Rad., Pastorex™ Meningitis). Streptococcus pneumonia (S ...
-
bioRxiv - Molecular Biology 2019Quote: ... The measurement was performed in sealed (Microseal B Adhesive Sealer, BioRad) black 96-well clear bottom plates (flat bottom ...
-
bioRxiv - Bioengineering 2020Quote: ... After sealing with a Microseal® B Adhesive sealer (Bio-Rad), the 96-well microplate was incubated at 37 °C for 1h and the end-point image was taken by ChemiDoc™ MP Imaging System (Bio-Rad).
-
bioRxiv - Biochemistry 2021Quote: ... Plates were sealed using Microseal B adhesive sealers (BioRad MSB-1001). The following day ...
-
bioRxiv - Microbiology 2019Quote: ... allelic assignation was done using Quantity one software (Biorad®) to determine the length of the PCR products for each of the 24 loci analyzed ...
-
bioRxiv - Bioengineering 2020Quote: ... and data were analyzed using Quantity One (Bio-Rad, USA). For the dsDNA cleavage assays ...
-
bioRxiv - Neuroscience 2019Quote: ... The samples were analysis by Quantity One BioSoft (BIO-RAD). Relative expression levels were normalized to that of tubulin ...
-
bioRxiv - Cell Biology 2021Quote: ... and quantified using Quantity One version 4.1.0 software (Bio-Rad).
-
bioRxiv - Neuroscience 2021Quote: ... and quantified using The Quantity One software v4.6.3 (Bio-Rad). Optical density values for CB1R were normalized to actin optical density values as loading control in the same sample and expressed as a percentage of control group (WT).
-
bioRxiv - Plant Biology 2021Quote: ... Hybridization results were quantified using Quantity One® (Bio-Rad) software ...
-
bioRxiv - Molecular Biology 2020Quote: ... Unbound DNA was quantified by the Quantity One software (BioRad). The gel was subsequently stained with Simply Blue (Invitrogen ...
-
bioRxiv - Molecular Biology 2020Quote: ... The analysis was done with the Quantity One software (BioRad). The experiment was conducted in five biological replicates.
-
bioRxiv - Physiology 2022Quote: ... Densitometry was performed using Quantity One 4.6.9 software (Bio-Rad).
-
bioRxiv - Bioengineering 2019Quote: ... with cumulative image recording using the Quantity One software (Biorad).
-
bioRxiv - Cancer Biology 2019Quote: ... then one hour and twenty minutes at 120 volts (Biorad) at 4oC ...
-
bioRxiv - Plant Biology 2020Quote: ... radioactivity counts were analyzed using Quantity One software (Bio-Rad). Statistical analysis was performed using GraphPad Prism software.
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... Densitometric scans were analyzed using Quantity One software (Bio-Rad). The value of the ricin band was determined as a percentage of the total protein in each lane ...
-
bioRxiv - Genetics 2021Quote: ... were quantified with Quantity-One software (Bio-Rad Laboratories, America). Sample in western blot was triplicate.
-
bioRxiv - Cancer Biology 2021Quote: ... The iTaq Universal SYBR Green One-Step Kit (Bio-Rad) was used to run the RT-qPCR reactions ...
-
bioRxiv - Animal Behavior and Cognition 2021Quote: ... and quantified by The Quantity One software v4.6.3 (Bio-Rad). Optical density values for target proteins were normalized to Ponceau staining of the nitrocellulose membrane as loading control ...
-
bioRxiv - Immunology 2021Quote: ... using the iTaq Universal Probes One-Step RTqPCR kit (BioRad) with N2 primers and probes targeting the nucleocapsid (36) ...
-
bioRxiv - Molecular Biology 2021Quote: ... The signals were quantified using Quantity One software (Bio-Rad), and normalized to the last sample (set as 1) ...
-
bioRxiv - Immunology 2021Quote: ... using the iTaq Universal Probes One-Step RTqPCR kit (BioRad) with N2 primers and probes targeting the nucleocapsid 41 ...
-
bioRxiv - Bioengineering 2022Quote: iTaq Universal Probes One-Step Kit (Biorad, cat. no. 1725141)
-
bioRxiv - Developmental Biology 2022Quote: ... Expression was evaluated by Quantity One® (v4.6.7, Bio-Rad) densitometry to adjust for equal amounts of expression using WCL of untransfected cells to maintain total protein content ...
-
bioRxiv - Immunology 2022Quote: ... the iTaq Universal Sybr green One-step kit (Bio-Rad) was used ...
-
bioRxiv - Molecular Biology 2022Quote: ... and analyzed with Quantity One 1-D software (Bio-Rad).
-
bioRxiv - Molecular Biology 2022Quote: ... or a QX ONE Droplet Digital PCR System (Bio-Rad) following the manufacturer’s recommendations ...
-
bioRxiv - Neuroscience 2023Quote: ... controlled by The Quantity One software v 4.6.9 (Bio-Rad). For quantitative purposes ...
-
bioRxiv - Microbiology 2023Quote: ... The gel was activated using one-minute setting (Bio-Rad Imager ...
-
bioRxiv - Cell Biology 2023Quote: ... Band intensity was measured using Quantity One software (Bio-Rad). Quantitative ratios were calculated based on the data and are presented as relative values.
-
bioRxiv - Plant Biology 2021Quote: ... thaliana (5’-CAGGCGGTGGAAACTACCAAG-3’ and 5’-TACAGCACTGCACGGGTCGAT-3’) and R129_E (5’-CGAGCTAATCTCCAAAAGCCATC-3’ and 5’-TGACCCTACCGTGGTTAGCTG-3’) with iQ SYBR Green Supermix (BIO-RAD), as described previously (Garrido-Oter et al. ...
-
bioRxiv - Immunology 2023Quote: ... 5’ GACGTGGGCTCCTTACACTGA 3’)(41) and 18s (Fwd: 5’ CTTAGAGGGACAAGTGGCG 3’, Rev: 5’ ACGCTGAGCCAGTCAGTGTA 3’)(42) using the SsoFast assay system (BioRad) was used to quantify transcripts in a BioRad CFX94 machine.
-
bioRxiv - Molecular Biology 2020Quote: ... Specific primers (Supplementary Table 7) and SSO SYBR Green Supermix (Bio-Rad) were used in qPCR reactions following manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2020Quote: ... CHAPS (3-((3-cholamidopropyl) dimethylammonio)-1-propanesulfonate) were purchased from Bio-Rad Laboratories ...
-
bioRxiv - Genomics 2020Quote: ... and reactions were covered with Microseal ‘B’ PCR Plate Seals (Biorad, CA) to avoid evaporation ...
-
bioRxiv - Genetics 2020Quote: ... Plates were sealed using a microseal ‘B’ Adhesive Seal (Bio-Rad MSB1001) and the reaction progress was recorded during 40 cycles using a C1000Touch plate reader (Bio-Rad) ...
-
bioRxiv - Genomics 2022Quote: ... The reaction was sealed with Microseal ‘B’ PCR Plate Seals (Biorad, CA) and incubated for at least 6h ...
-
bioRxiv - Synthetic Biology 2022Quote: ... The plate was sealed with a microseal B adhesive (Bio-Rad MSB1001) and incubated in a plate reader with continuous shaking for 18 hr at 37 °C and absorbance measurements at 600 nm every 15 min.
-
bioRxiv - Immunology 2023Quote: Magic Red® Cathepsin (B, L or K) assay kit (Bio-Rad) was used to determine the activity of cathepsin in cells ...
-
bioRxiv - Cell Biology 2020Quote: ... and films were scanned and analysed using Quantity One (Bio-Rad).
-
bioRxiv - Molecular Biology 2021Quote: ... iTaq Universal SYBR Green One-step kit (Bio-Rad, Hercules, CA) with DENV-2 specific primers and following a standard protocol (S1 Table ...