Labshake search
Citations for Bio-Rad :
151 - 200 of 4114 citations for 4 Hydroxy 7 trifluoromethyl quinoline 3 carbohydrazide since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Pathology 2024Quote: ... non–linear 3-10 pH gradient (Bio-Rad), followed by SDS-PAGE separation on 8-16% polyacrylamide gradient midi gels (Criterion TGX gels ...
-
bioRxiv - Neuroscience 2020Quote: ... Proteins were separated on 4%-15% or 4%-20% Criterion TGX precast protein gels (64134751; Bio-Rad), and transferred to an Immun-Blot PVDF membrane (1620177 ...
-
bioRxiv - Biochemistry 2024Quote: ... then loaded on 4–15% or 4-20% polyacrylamide Tris-glycine gradient gels (Bio-Rad, Hercules, CA). Following electrophoresis ...
-
bioRxiv - Cancer Biology 2020Quote: ... The plate was run on an ABI ViiA 7 instrument and analyzed with CFX manager software (Bio-Rad).
-
bioRxiv - Neuroscience 2023Quote: ... and transferred onto nitrocellulose at 25 V for 7 min using the Trans-blot Turbo system (Bio-Rad). Blotting efficiency was visualized by red Ponceau staining on membranes ...
-
bioRxiv - Biochemistry 2023Quote: ... and transferred at 1.3 A/25 V for 7 min using the Trans-Blot Turbo system (Bio-Rad). Afterwards ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... then transferred semi-dry for 7 min at 1.3 mV using Trans-Blot Turbo 0.2 mm nitrocellulose transfer packs (BioRad). Blots were blocked with Odyssey blocking buffer ...
-
bioRxiv - Genetics 2022Quote: ... reverse 5’ - CACGTGGGACCGCTCGTCTCC) and MUC3B-specific primers (forward 5’ CGGGGGCCAGTGGGATGGCCTCAAG-3’; reverse 5’-CACGCGGGACCGCTCGTCTCT-3’) using SsoFast EvaGreen Supermix (#1725200, Bio-Rad) on a CFX96 Real-Time PCR Detection System (Bio-Rad ...
-
bioRxiv - Cancer Biology 2021Quote: ... qPCR analysis was performed using 1 μl diluted cDNA with biological (2-3) and technical replicates (2-3) using SsoAdvanced SYBR reagent (Bio-Rad) and Bio-Rad qPCR platform ...
-
bioRxiv - Immunology 2022Quote: ... and mouse hypoxanthine-guanine phosphoribosyltransferase gene (Hprt) (forward, 5’-GGACTTGAATCAAGTTTGTG-3’; reverse, 5’-CAGATGTTTCCAAACTCAAC-3’) in a CFX96 Real-Time PCR Detection System (Bio-Rad). The qRT-PCR results were analyzed using the ΔCt method (relative expression ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... 5’-TAA TCA GAC AAG GAA CTG ATT A-3’ // Reverse: 5’-CGA AGG TGT GAC TTC CAT G-3’) and CFX96 Touch Real-Time PCR Detection System (Bio-Rad).
-
bioRxiv - Microbiology 2023Quote: ... US28 (sense, 5’-CCAGAATCGTTGCGGTGTCTCAGT-3’; antisense, 5’-CGTGTCCACAAACAGCGTCAGGT-3’) and GAPDH were detected with CFX Connect Real Time System (Bio-Rad) using iTaq Universal SYBR Green Supermix (Bio-Rad) ...
-
bioRxiv - Microbiology 2023Quote: ... and primer set previously described [25] CtPl+ 5’-TAGTAACTGCCACTTCATCA-3’ and CtP2 5’-TTCCCCTTGTAATTCGTTGC-3’) and using a CFX96TM real-time thermocycler (Bio-Rad)) ...
-
bioRxiv - Molecular Biology 2024Quote: ... and blocked in Odyssey PBS blocking buffer 1:3 in 1x PBS (Li-Cor, 927-40000) or EveryBlot blocking buffer 1:3 in 1x PBS (Biorad, 12010020) for 30 min (Odyssey ...
-
bioRxiv - Cancer Biology 2022Quote: ... Protein separation was performed on Mini-Protean TGX (4-15% or 4-20%) SDS-PAGE gel (Bio-Rad) and transferred to PVDF membranes (Bio-Rad) ...
-
bioRxiv - Cancer Biology 2021Quote: ... 4 were incubated overnight at 4°C and revealed using peroxidase-conjugated antibodies and an ECL kit (BioRad). Images were captured using ChemiDocTM XRS Imaging system (Biorad).
-
bioRxiv - Immunology 2022Quote: ... incubated for five days at 4°C in 40 mL of hydrogel monomer solution [4% acrylamide (Bio-Rad), 0.05% bis-acrylamide (Bio-Rad) ...
-
bioRxiv - Cell Biology 2023Quote: ... and resolved by SDS-PAGE using Criterion XT Bis-Tris precast gels (4-12%; BioRad, 3450123/4/5) and XT-MES1X as running buffer (stock 10X ...
-
bioRxiv - Cancer Biology 2023Quote: ... All western blots were run using PROTEAN TGX precast 4-15% or 4-20% gradient gels (Bio-Rad) and transferred to either 0.2μm or 0.44μm nitrocellulose membranes ...
-
bioRxiv - Cell Biology 2023Quote: ... Samples were run on 4-15% or 4-20% Mini-PROTEAN SDS-PAGE gels (Bio-Rad, Hercules, CA) in 1X TGS solution (250 mM tris ...
-
bioRxiv - Physiology 2024Quote: ... Proteins were resolved in 4–20% or 4–15% Mini-PROTEAN TGX gels (BIORAD, 4561093 and 4561083, respectively) and transferred onto TransblotTurbo midi-size nitrocellulose membranes (0.2 μm pore size ...
-
bioRxiv - Molecular Biology 2020Quote: ... or 4-15% Mini Protean gels (BioRad). Proteins were transferred to nitrocellulose membrane using Turbo-blotter (Bio-Rad) ...
-
bioRxiv - Developmental Biology 2020Quote: ... with 4% goat (Bio-Rad Laboratories, #C07SA) or donkey serum (Bio-Rad Laboratories ...
-
bioRxiv - Bioengineering 2020Quote: ... Polyacrylamide gels (Bio-Rad, 4-16 wt%). IFNγ ELISA (DY485 ...
-
bioRxiv - Neuroscience 2020Quote: ... or 4-15% (BIO-RAD #456-1083) Mini PROTEAN® gel in Tris/Glycine/SDS (BIO-RAD #1610772) ...
-
bioRxiv - Neuroscience 2022Quote: Criterion TGX 4-15% (Bio-Rad 5671084) and Mini-Protean TGX precast gels (Bio-Rad 4561083 ...
-
bioRxiv - Molecular Biology 2021Quote: 4-20% precast SDS PAGE gels (BioRad) were used for electrophoretic separation of immuno purified samples ...
-
bioRxiv - Immunology 2021Quote: ... 4-15% gradient gels (Bio-Rad 4561086) and transferred to PVDF membranes (ThermoFisher ...
-
bioRxiv - Genetics 2021Quote: ... 4% (wt/vol) acrylamide (Bio-Rad, USA), 0.05% (wt/vol ...
-
bioRxiv - Neuroscience 2021Quote: ... 4% w/v acrylamide (Bio-Rad 1610140), 0.05% w/v bis-acrylamide (Bio-Rad 1610142) ...
-
bioRxiv - Plant Biology 2020Quote: ... in 4-mm electroporation cuvettes (Bio-Rad) with the following setting ...
-
bioRxiv - Cell Biology 2021Quote: ... 4-20% gradient (Bio-Rad, Hercules, California), and in the case of immunoblot analysis ...
-
bioRxiv - Cell Biology 2021Quote: ... separated in 4-20% SDS–PAGE (BioRad) and electroblotted to nitrocellulose membrane ...
-
bioRxiv - Molecular Biology 2022Quote: ... or 4-20% TGX (Bio-Rad, 4561096) for visualization of auto- ubiquitylation or substrate ubiquitylation ...
-
bioRxiv - Bioengineering 2022Quote: ... Polyacrylamide gels (Bio-Rad, 4-16 wt%). IFNγ ELISA (430104 ...
-
bioRxiv - Cancer Biology 2022Quote: ... 4 mm gap (Bio-Rad, Hercules, CA) containing 20 µg pCas-Ov-grn-1 ...
-
bioRxiv - Molecular Biology 2022Quote: ... separated by 4-15% SDS-PAGE (BioRad), transferred and treated with a polyclonal rabbit anti-TDP-43 antibody (ProteinTech ...
-
bioRxiv - Neuroscience 2023Quote: ... or 4-20% Tris-glycine gel (BioRad) and blotted on a PVDF membrane (BioRad) ...
-
bioRxiv - Cell Biology 2024Quote: ... precast 4-20 % gradient gels (BioRad #4561095). Recombinant N-terminally acetylated αSyn at indicated concentrations was loaded as reference input ...
-
bioRxiv - Immunology 2024Quote: ... An SDS 4-20% gel (BioRad # 4561094) was used for protein separation under non-reducing conditions ...
-
bioRxiv - Synthetic Biology 2024Quote: ... or 4–20% SDS-PAGE (Bio-Rad) and then transferred onto PVDF membranes using the Transblot-turbo system (Bio-Rad) ...
-
bioRxiv - Cell Biology 2024Quote: ... 4% SDS (Bio-Rad, cat#161-0203), 20% glycerol (Invitrogen ...
-
bioRxiv - Cancer Biology 2022Quote: ... 5’ - GAT GGA GAA AGC TCT GAG CAT C -3’ Reverse: 5’ - TTG CTC CAC AGA TGG AGT TG -3’ RHAMM PrimePCR primers were obtained from BioRad (Cat#: 10025636)
-
bioRxiv - Microbiology 2024Quote: ... The hypervariable region V3–V4 of the bacterial 16S rRNA gene was amplified using the primers 338F (5’-ACTCCTACGGGAGGCAGCAG-3’)/ 806R (5’-GGACTACHVGGGTWTCTAAT-3’) by using a T100 Thermal Cycler PCR thermocycler (BIO-RAD, USA). The PCR reaction mixture (20 µL ...
-
bioRxiv - Developmental Biology 2021Quote: ... was performed in 7 min at 1.3 A and 25 V using a Trans-Blot TurboTM transfer system (BioRad). Recognition and revelation of the his-tagged protein was performed as described for the Dot Blot ...
-
bioRxiv - Molecular Biology 2022Quote: ... LarA extracted from a 7 cm prep well Mini-PROTEAN® TGX Stain-Free™ gel (#4568091, Bio-Rad) was used for affinity purification of the final antibody.
-
bioRxiv - Synthetic Biology 2022Quote: ... The reaction was run for 7 h at 34 °C on a CFX96 real-time PCR detection system (Biorad) and monitored thanks to the SYBR Green II signal.
-
bioRxiv - Synthetic Biology 2024Quote: ... followed by incubation at 37 °C for up to 7 hours on a real-time qPCR instrument (Biorad, CFX96). To measure the time-dependent change in fluorescence ...
-
bioRxiv - Microbiology 2024Quote: ... supplemented with 2% w/v CA and treated with (7% w/v) Chelex100 resin (Bio-Rad, Mississauga, ON, Canada) at 4°C overnight ...
-
bioRxiv - Immunology 2024Quote: ... was introduced by electroporation (7 square wave pulses of 30 V, 3ms, 0,1s pause) using a GenePulser Xcell electroporator (Biorad) and a 1 mm cuvette (Biorad) ...