Labshake search
Citations for Bio-Rad :
151 - 200 of 7820 citations for 2 Aminomethyl 1 3 thiazole 4 carboxylic Acid Hydrochloride since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2024Quote: ... lysates were collected and mixed 3:1 with 4x Laemmli sample buffer (Bio-Rad 1610747). Samples were heated at 95°C for 10 min and then separated on SDS-PAGE and transferred to polyvinylidene difluoride (PVDF ...
-
bioRxiv - Cell Biology 2024Quote: ... Membrane was washed 3 times and incubated with secondary peroxidase antibodies (1:1000, Bio-RAD) 1 hour in TBS-Tween 1% ...
-
bioRxiv - Microbiology 2020Quote: ... which subsequently performed 2-DE using a 7 cm immobilized pH gradient (IPG) strips (pH range of 3—10, Ready strip, Bio-Rad, USA).
-
bioRxiv - Cancer Biology 2023Quote: ... Samples were heated to 50°C for 2 to 3 min before the addition of 40 μl molten CleanCut agarose (Bio-Rad 1703594), vortexed vigorously for 5 sec before pipetting in plug mould (Bio-Rad 1703713) ...
-
bioRxiv - Plant Biology 2021Quote: ... thaliana (5’-CAGGCGGTGGAAACTACCAAG-3’ and 5’-TACAGCACTGCACGGGTCGAT-3’) and R129_E (5’-CGAGCTAATCTCCAAAAGCCATC-3’ and 5’-TGACCCTACCGTGGTTAGCTG-3’) with iQ SYBR Green Supermix (BIO-RAD), as described previously (Garrido-Oter et al. ...
-
bioRxiv - Immunology 2023Quote: ... 5’ GACGTGGGCTCCTTACACTGA 3’)(41) and 18s (Fwd: 5’ CTTAGAGGGACAAGTGGCG 3’, Rev: 5’ ACGCTGAGCCAGTCAGTGTA 3’)(42) using the SsoFast assay system (BioRad) was used to quantify transcripts in a BioRad CFX94 machine.
-
bioRxiv - Immunology 2023Quote: ... Primary antibody staining was performed overnight at 4&C using rabbit anti-mouse Iba-1 (1:500; Wako Chemical Cat #019-19741) and CD68 (1:200; Bio-Rad Cat #MCA1957) with secondary staining performed for 45 minutes RT using Alexa Flour 594 donkey anti-rabbit (1:400 ...
-
bioRxiv - Microbiology 2020Quote: ... concentration of total aerobic GNB and of MDR-GNB were determined by plating serial dilutions (pure, 10−2, 10−4) of initial faeces or EA sample onto Drigalski agar (Bio-Rad) with or without 1mg/L cefotaxime ...
-
bioRxiv - Biophysics 2020Quote: ... Inputs (2 μl) and elutions (10 μl) samples were analyzed by 4-15% SDS-PAGE (MINI-PROTEAN TGX stain-free, Bio-Rad) and staining with Quick Coomassie (Generon ...
-
bioRxiv - Microbiology 2021Quote: ... The concentration of Amphipol 8-35 was brought up to 35mg/ml and incubated at room temperature for 4 hours then Bio-Beads SM-2 (Bio-Rad) were added and incubated for 16 hours at 4°C ...
-
bioRxiv - Microbiology 2021Quote: ... The concentration of Amphipol 8-35 was brought up to 35mg/ml and incubated at room temperature for 4 hours then Bio-Beads SM-2 (Bio-Rad) were added and incubated for 16 hours at 4°C ...
-
bioRxiv - Microbiology 2022Quote: ... This panel had been tested negative for SARS-CoV-2 nucleocapsid protein expression using Bio-Plex Pro Human IgG SARS-CoV-2 N/RBD/S1/S2 4-Plex Panel (Bio-rad). The second serum panel (n=29 ...
-
bioRxiv - Molecular Biology 2024Quote: ... 0.5% of total input and 15% of total IP fraction were resolved on 10% SDS-PAGE gels and wet transferred onto a 0.45 µm nitrocellulose membrane for 2 h at 80 V and 4°C (Bio-Rad, Germany). The membrane was blocked for 1 h in 5% BSA in PBST (PBS + 0.2% Tween20) ...
-
bioRxiv - Cancer Biology 2024Quote: ... The samples were then transferred to a PVDF membrane at 400mA for 2 hours at 4°C in 1x Tris/Glycine buffer (1610771, Bio-Rad). Membranes were then blocked in casein blocking buffer (PI37528 ...
-
bioRxiv - Microbiology 2023Quote: ... This panel had been tested negative for SARS-CoV-2 nucleocapsid protein expression using Bio-Plex Pro Human IgG SARS-CoV-2 N/RBD/S1/S2 4-Plex Panel (Bio-rad). The second panel consisted of 20 sera from individuals who were previously infected by SARS-CoV-2 vaccinated with 2-4 doses of parental mRNA vaccine ...
-
bioRxiv - Microbiology 2022Quote: ... This panel had been tested negative for SARS-CoV-2 nucleocapsid protein expression using Bio-Plex Pro Human IgG SARS-CoV-2 N/RBD/S1/S2 4-Plex Panel (Bio-rad). The second panel consisted of 29 sera collected from individuals 1 month after BA.5-bivalent-booster of Pfizer or Moderna vaccine ...
-
bioRxiv - Cell Biology 2024Quote: ... clarified at 20,000 g for 2 minutes and 15 µL was loaded onto a 4-20% tris-glycine SDS-PAGE gel (Biorad #5671094). Proteins were then transferred to nitrocellulose (Sigma #10600001 ...
-
bioRxiv - Molecular Biology 2021Quote: ... Protein samples were mixed 1:4 with 4X Laemmli buffer (Bio-Rad, Lunteren, Netherlands) containing 10% (v/v ...
-
bioRxiv - Genomics 2024Quote: ... and counted (1:4 dilution) with TC20 Automated Cell Counter (Bio-rad cat. #1450102). Cells were fixed using Parse Biosciences’ Nuclei Fixation Kit v1 (Parse Biosciences cat ...
-
bioRxiv - Cell Biology 2023Quote: ... for 1 h at 4°C using the Mini Trans-Blot Cell (Bio-Rad). After the transfer ...
-
bioRxiv - Cell Biology 2024Quote: ... for 1 h at 4°C using the Mini Trans-Blot Cell (Bio-Rad). After the transfer ...
-
bioRxiv - Cell Biology 2024Quote: ... for 1 h at 4°C using the Mini Trans-Blot Cell (Bio-Rad). After the transfer ...
-
bioRxiv - Bioengineering 2023Quote: ... This step was repeated for 3 times and the samples were concentration-matched at OD500nm = 10 and mixed 1:1 with 2x Laemmli buffer (Bio-Rad), containing SDS and 2-mercaptoethanol ...
-
bioRxiv - Neuroscience 2023Quote: ... 6-diamidino- 2-phenylindole (DAPI) (1 ug/mL; Bio-Rad, Cat.# 1351303) to counterstain for confocal microscopy ...
-
bioRxiv - Cell Biology 2024Quote: ... and rat anti-α tubulin (YL1/2) (MCA77G, Bio-Rad; 1:1500). Secondary antibodies used were Alexa Fluor 488 goat anti-mouse IgG (H + L ...
-
bioRxiv - Molecular Biology 2022Quote: ... at a 1:5 w/w ratio for 2 hours before addition of 100 mg mL-1 Bio-Beads SM-2 resin (Bio-Rad) and then incubated overnight at 4 °C with gentle agitation to remove detergent ...
-
bioRxiv - Molecular Biology 2024Quote: ... The reaction was resolved by electrophoresis on a 6% non-denaturing polyacrylamide gel in TBE (100 mM Tris, 90 mM boric acid, 1 mM EDTA) buffer and visualised by ChemiDoc (BioRad) using SYBR Gold stain or imaging in the 6FAM ...
-
bioRxiv - Molecular Biology 2020Quote: ... Normalised samples (1 – 3 µg) were electrophoresed on 12% Mini-Protean TGX Stain-Free gels (BioRad) or 4-20% Criterion TGX Stain-Free Precast gels (BioRad ...
-
bioRxiv - Microbiology 2024Quote: ... 10% glycerol) then boiled with 1/3 volume of 4x Laemmli sample buffer (Bio-Rad, 1610747) for 10 mins ...
-
bioRxiv - Biochemistry 2023Quote: ... expression media samples were diluted with 2X reducing SDS sample buffer at 1:1 ratio and the mixture was loaded on a 10-well 4–20% SDS-PAGE gradient gel (BioRad). Image J software was used to quantify the signal compared to the negative control (mock transfected culture) ...
-
bioRxiv - Cancer Biology 2024Quote: ... WHO°3 n=3) using the Bio-Plex Cell Lysis Kit (Bio-Rad) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2021Quote: ... 4-15% Tris-HCI 4 SDS-PAGE gels (Bio-Rad), separated at 120V ...
-
bioRxiv - Neuroscience 2021Quote: ... Samples were then loaded onto 4-15% Criterion™ TGX™ Precast Midi Protein Gels (12 + 2 wells, 45 μl) (Bio-Rad) and subjected to SDS-PAGE at 200 V for ~45 min in 10× Tris/Glycine/SDS running buffer (Bio-Rad) ...
-
bioRxiv - Plant Biology 2020Quote: ... Incubate 1 μL of reticulocyte extract before binding with beads and 2 μL of extract after the binding was used for each western on a precast gel (4–20% Criterion™ TGX™ Precast Midi Protein Gel, 12+2 well, 45 μl, BioRad). Before loading ...
-
bioRxiv - Cell Biology 2021Quote: ... 1∼2 μg of total protein for each lane) was loaded on a precast 4-20% gradient polyacrylamide gel (PAGE, Bio-Rad: 4561096) and electrophoresed at a constant voltage of 200 V for 35 min ...
-
bioRxiv - Cancer Biology 2024Quote: ... Protein pellet was resuspended in UTC buffer (8 M urea, 2 M thiourea, 4% CHAPS) and quantified using RC DC™ Protein Assay Kit (Bio-Rad). Sample with 80 µg proteins resuspended in rehydration buffer (8 M urea ...
-
bioRxiv - Immunology 2023Quote: Serum binding antibody assays were performed to evaluate IgG responses to SARS-CoV-2 nucleocapsid and ancestral spike S2 domains and RBD using the Bio-Plex Pro Human SARS-CoV-2 IgG (N, S2, RBD) 4-Plex Panel serology assay (Bio-Rad 12014634) as previously described (8).
-
bioRxiv - Pathology 2024Quote: ... Samples were separated by electrophoresis for 2 hr at 60-100 V using 4% to 20% precast gradient gels (MiniPROTEAN TGX; Bio-Rad, #4561094) in 1X SDS-Tris-glycine buffer (Bio-Rad ...
-
bioRxiv - Pathology 2024Quote: ... the samples were separated by electrophoresis for 2 hours at 60-100 V using 4% to 20% precast gradient gels (Mini-PROTEAN TGX; Bio-Rad, #4561094) in 1X SDS-Tris-Glycine buffer (Bio-Rad ...
-
bioRxiv - Cell Biology 2024Quote: The autophagosome preparations (in 2×Laemmili buffer) or 10 μg total tissue lysates (in 2×Laemmili buffer) were run into 4–20% precast gel (Bio-Rad, 4561094) for around 1 cm distance ...
-
bioRxiv - Biochemistry 2024Quote: ... 4-20% (BioRad), or 6% (Thermofisher ...
-
bioRxiv - Cell Biology 2021Quote: ... cDNA was 1:4 diluted in water and mixed with SYBR® Green (Bio-Rad) and the appropriate primers at 5µM ...
-
bioRxiv - Biophysics 2020Quote: ... Color Development was obtained using the chromogenic substrate 4-chloro-1-naphthol (4CN, Bio-Rad) and H2O2.
-
bioRxiv - Plant Biology 2023Quote: ... for 1 h at 4 °C and incubated with protein-G magnetic beads (Bio-rad) for 0.5 h at 4 °C ...
-
bioRxiv - Molecular Biology 2024Quote: ... The samples were resolved 1 cm into a 4-20% precast TGX gel (Biorad, 4561093), stained ...
-
bioRxiv - Genomics 2024Quote: ... then embedded in an acrylamide gel (4% v/v 19:1 acrylamide:bis-acrylamide (Bio-Rad), 300 mM NaCl ...
-
bioRxiv - Cancer Biology 2020Quote: ... cells were resuspended in agarose insert buffer and mixed 1:1 with 2% low-melting agarose (Bio-Rad). Gel inserts were solidified at 4°C for overnight and were stored in agarose insert buffer until analysis ...
-
bioRxiv - Biochemistry 2020Quote: To visualize protein expression 1 μL of the TXTL reactions was mixed with 2 μL of water and 3 μL of 2x Laemmli loading dye (Bio-Rad, Hercules, CA, USA) and incubated at 90°C for 3 min ...
-
bioRxiv - Genetics 2023Quote: ... China) using TBE (65 mM Tris-HCl, 27 mM boric acid, 1 mM EDTA, pH 9; Bio-Rad, Hercules, CA, USA) as the buffer ...
-
bioRxiv - Cell Biology 2024Quote: ... After gel polymerization was performed pre-electrophoresis of empty gel in 5% acetic acid (running buffer) for 1-1.5h/150 V in reverse polarity of electrophoretic BioRad system (Bio-rad, USA). The running buffer was discarded ...