Labshake search
Citations for Bio-Rad :
151 - 200 of 4573 citations for 14 Nonylphenoxy 3 6 9 12 tetraoxatetradecan 1 ol since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2024Quote: ... Lysates were run on 12% SDS-polyacrylamide gel (BioRad) by electrophoresis and transferred to Nitrocellulose (BioRad ...
-
bioRxiv - Immunology 2024Quote: ... and Fluorescein isothiocyanate-anti-CD3ε (CD3-12, BioRad MCA1477F). Samples were analyzed on a 6-laser Cytoflex LX (Beckman Coulter ...
-
bioRxiv - Biochemistry 2024Quote: ... run on a 4-12 % TGX precast gel (Biorad), proteins transferred onto nitrocellulose membrane at 80 V for 90 min and detected by immunoblotting with the antibodies indicated.
-
bioRxiv - Cell Biology 2024Quote: ... then resolved by SDS PAGE (12% TGX gels, BioRad) and transfered to 0.2 μm nitrocellulose membrane (Bio-RAD ...
-
bioRxiv - Synthetic Biology 2021Quote: Supernatant or periplasmic fractions were diluted 3:1 in 4× Laemmli sample buffer (Bio-Rad) and were boiled at 100 °C for 10 min ...
-
bioRxiv - Cancer Biology 2020Quote: ... Protein samples were diluted (3:1) with a 4x Laemmli sample buffer (Biorad, Cat# 1610747) and heated at 98 °C for 5 min ...
-
bioRxiv - Bioengineering 2023Quote: ... for 1–3 hours at 100 V and then transferred to PVDF membrane (Bio-Rad) at 40 V for 2–8 hours ...
-
bioRxiv - Microbiology 2024Quote: ... lysates were collected and mixed 3:1 with 4x Laemmli sample buffer (Bio-Rad 1610747). Samples were heated at 95°C for 10 min and then separated on SDS-PAGE and transferred to polyvinylidene difluoride (PVDF ...
-
bioRxiv - Cell Biology 2024Quote: ... Membrane was washed 3 times and incubated with secondary peroxidase antibodies (1:1000, Bio-RAD) 1 hour in TBS-Tween 1% ...
-
bioRxiv - Microbiology 2023Quote: ... 6’,-diamidino-2-phenylindole (DAPI; BIO-RAD) at room temperature for 30 minutes ...
-
bioRxiv - Plant Biology 2021Quote: ... thaliana (5’-CAGGCGGTGGAAACTACCAAG-3’ and 5’-TACAGCACTGCACGGGTCGAT-3’) and R129_E (5’-CGAGCTAATCTCCAAAAGCCATC-3’ and 5’-TGACCCTACCGTGGTTAGCTG-3’) with iQ SYBR Green Supermix (BIO-RAD), as described previously (Garrido-Oter et al. ...
-
bioRxiv - Immunology 2023Quote: ... 5’ GACGTGGGCTCCTTACACTGA 3’)(41) and 18s (Fwd: 5’ CTTAGAGGGACAAGTGGCG 3’, Rev: 5’ ACGCTGAGCCAGTCAGTGTA 3’)(42) using the SsoFast assay system (BioRad) was used to quantify transcripts in a BioRad CFX94 machine.
-
bioRxiv - Microbiology 2021Quote: ... PCR conditions followed the general Bio-Rad recommendations.9 Data was analyzed with QuantaSoft_v1.7 software (Bio-Rad) including automatic Poisson correction.9,11
-
bioRxiv - Systems Biology 2023Quote: ... then cells stained for analysis by flow cytometry 9 or 10 days after dCas9 infection (BioRad ZE5). In some cases ...
-
bioRxiv - Cancer Biology 2021Quote: ... For immunohistochemistry (IHC) experiments following primary antibodies were used: IgG anti-human CD3 antibody (1:200, clone CD3-12, Bio-Rad) and anti-PCNA antibody (1:1000 ...
-
bioRxiv - Biochemistry 2021Quote: ... and fractionated into 12 fractions (1ml each) using a Beckman fraction recovery system connected to an EM-1 UV monitor (Bio-Rad).
-
bioRxiv - Biophysics 2020Quote: ... supplemented with DTT (0.1 M endconcentration) and then subjected to SDS-PAGE on 12% or 4–20% gradient gels (mini-PROTEAN TGX; Bio-Rad). Proteins were transferred to PVDF membranes (TransBlot® TurboTM LF PVDF ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... were added to the control wells without cells (Lanes 1 and 12) ranging from 0.125 – 2 mg/ml (BioRad 500-0202) and treated with formalin and NaOH at the same concentrations as the cells ...
-
bioRxiv - Bioengineering 2023Quote: ... This step was repeated for 3 times and the samples were concentration-matched at OD500nm = 10 and mixed 1:1 with 2x Laemmli buffer (Bio-Rad), containing SDS and 2-mercaptoethanol ...
-
bioRxiv - Biochemistry 2023Quote: ... pre-run for 1 hour at 4 ° C and run for 1 hour at 120 volts on Mini-Protean 3 gels (Bio-Rad).
-
bioRxiv - Genetics 2023Quote: ... followed by purification and size selection on 1% agarose gel with .6 µg/mL ethidium bromide (BioRad Cat#1610433), selecting for the 7,961 bp band ...
-
bioRxiv - Cancer Biology 2024Quote: ... 1 x 10^6 cells were electroporated with RNPs in Gene Pulser electroporation buffer (#1652676, Bio-Rad, Hercules, CA) with electroporation enhancer (#1075915 ...
-
bioRxiv - Microbiology 2021Quote: ... pulse times 6-36 s at 6 V/cm on a Bio-Rad CHEF MAPPER apparatus (Bio-Rad Laboratories). Restriction profiles were analyzed using the BioNumerics version 7.10 finger-printing software.
-
bioRxiv - Bioengineering 2021Quote: ADMSC metabolic activity was tracked over 14 days using the alamarBlue® Cell Viability Assay (Bio-Rad). Media was removed from samples of S-50 or P-0 (n = 5 each) ...
-
bioRxiv - Cell Biology 2021Quote: ... 2-3 μg of total protein were loaded onto 10% SDS-polyacrylamide (29:1 Bio-Rad) gels with 10 μM phostag reagent (FUJIFILM Wako Chemicals ...
-
bioRxiv - Microbiology 2024Quote: ... 10% glycerol) then boiled with 1/3 volume of 4x Laemmli sample buffer (Bio-Rad, 1610747) for 10 mins ...
-
bioRxiv - Microbiology 2021Quote: ... Samples were loaded onto a 4-12% polyacrylamide gel (BioRad) and electrophoresed at 150V for 10 mins ...
-
bioRxiv - Cell Biology 2021Quote: ... Samples were separated on 12% SDS-PAGE mini gels (BioRad). Proteins were transferred to nitrocellulose membranes and blocked overnight at 4°C or for 1 hour at room temperature in 5% non-fat dry milk/TBS ...
-
bioRxiv - Genomics 2020Quote: ... and run on 12% SDS PAGE gels (456-1044, BioRad) with colorimetric ladder (RPN800E ...
-
bioRxiv - Neuroscience 2020Quote: ... Proteins were resolved on 12% SDS-PAGE gels(Bio-Rad) and transferred to nitrocellulose membranes(ThermoFisher) ...
-
bioRxiv - Cancer Biology 2021Quote: ... Samples were resolved using 8% or 12% SDS-PAGE (BioRad) or 4-12% gradient NuPAGE Protein Gel (Thermo Fisher) ...
-
bioRxiv - Cancer Biology 2022Quote: ... Proteins were separated on 12% Tris-Glycine acrylamide gels (BioRad), transferred to nitrocellulose membranes (BioRad) ...
-
bioRxiv - Neuroscience 2021Quote: ... and were electrophoresed using 4-12% SDS-PAGE gels (BioRad). Proteins were transferred ...
-
bioRxiv - Genetics 2021Quote: ... were resolved on Criterion XT 12% Bis-Tris gels (BioRad) in XT MOPS Running buffer (BioRad) ...
-
bioRxiv - Neuroscience 2021Quote: ... or 12% Criterion TGX Stain-free SDS-PAGE (Bio-Rad) and blotted onto 0.45 μm nitrocellulose membrane (Bio-Rad ...
-
bioRxiv - Microbiology 2021Quote: ... electrophoresed on 4-12% Bis-Tris protein gels (Bio-Rad) and transferred to PVDF membranes using Trans-Blot Turbo Transfer System (Bio-Rad) ...
-
bioRxiv - Cell Biology 2021Quote: ... 7.5 or 12% TGX Stain-Free SDS- polyacrylamide gels (BioRad) were cast according to the instructions of the manufacturer and 5 to 15 µg of total protein were subjected to SDS gel electrophoresis using 1X SDS running buffer (25 mM Tris ...
-
bioRxiv - Plant Biology 2023Quote: ... followed by 12% SDS-PAGE separation (Bio-Rad, 1610175, USA) and immunoblotting with custom monoclonal mouse antibodies specific for GmAlfin09 (BPI ...
-
bioRxiv - Biophysics 2023Quote: ... samples were loaded onto 12% Tris-glycine gels (#1658015, Biorad). Proteins were transferred onto ethanol-activated PVDF membranes (#1620177 ...
-
bioRxiv - Cell Biology 2022Quote: ... A PBS solution containing 12% acrylamide (161-0140, Bio-Rad), 0.15% bis-acrylamide (161-0142 ...
-
bioRxiv - Biochemistry 2024Quote: ... Stain free gels (4-12%) were obtained from Bio-Rad Laboratories (Hercules ...
-
Synthetase and Hydrolase Specificity Collectively Excludes 2’-Deoxyguanosine from Bacterial AlarmonebioRxiv - Microbiology 2024Quote: ... and resolved on 12% TGX-PAGE (Bio-Rad, Mini Protean) at 100V for 1 hour.
-
bioRxiv - Microbiology 2023Quote: ... loaded in a 4%-12% Bis Tris gel (Bio-Rad) and transferred to a PVDF membrane (Millipore Sigma) ...
-
bioRxiv - Immunology 2022Quote: ... TGX Stain-free FastCast Acrylamide 12% gel (Bio-Rad Laboratories) were used to separate proteins that were transferred on Transblot Turbo polyvinylidene fluoride membranes (Bio-Rad laboratories ...
-
bioRxiv - Neuroscience 2022Quote: ... Samples were electrophoresed with 12% Criterion TGX precast gels (BioRad) and transferred to PVDF membranes (Millipore) ...
-
bioRxiv - Biochemistry 2024Quote: ... resolved on a 4–12% Bis-Tris gel (Bio-Rad), and transferred onto Immuno-Blot PVDF (Bio-Rad) ...
-
bioRxiv - Biochemistry 2024Quote: ... 4-12% Criterion XT Bis-Tris protein gels (Bio-Rad) were used (Fig ...
-
bioRxiv - Cell Biology 2024Quote: ... Samples were resolved by SDS PAGE (12% TGX gels, BioRad) and transfered to 0.2 micron nitrocellulose via wet transfer (25 mM Tris ...
-
bioRxiv - Cancer Biology 2024Quote: ... or 4–12% Criterion™ XT Bis-Tris Gel (BioRad). The proteins were transferred to Trans-Blot Turbo Midi 0.2 µm Nitrocellulose (BioRad ...
-
bioRxiv - Cancer Biology 2024Quote: ... WHO°3 n=3) using the Bio-Plex Cell Lysis Kit (Bio-Rad) according to the manufacturer’s instructions ...