Labshake search
Citations for Bio-Rad :
1901 - 1950 of 10000+ citations for rno mir 137 3p Real time RT PCR Detection Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... Thermocycling was carried out in CFX96 RT-PCR detection system (Bio-Rad) using SYBR green fluorescence detection ...
-
bioRxiv - Microbiology 2020Quote: ... All gene transcripts were quantified by quantitative PCR using qScript™ One-Step qRT-PCR Kit (Quanta Biosciences, #95057-050) on CFX96 real-time PCR system (Bio-Rad). Primer sequences for qPCR were as follow ...
-
bioRxiv - Cancer Biology 2021Quote: ... Real-time quantitative reverse transcription (qRT)-PCR analysis was performed on a CFX96 real-time system (Bio-Rad Laboratories Srl) under the following conditions ...
-
bioRxiv - Molecular Biology 2021Quote: ChIP- and DRIP-derived DNA samples were subjected in triplicates (1.5 - 2 µl) to quantitative real-time PCR (qPCR) analysis on a CFX96 Real-Time Analyzer (Bio-Rad) using iQ SYBR Green Supermix reagent (Bio-Rad ...
-
bioRxiv - Developmental Biology 2023Quote: ... we ran real-time quantitative polymerase chain reactions (qPCR) on a BioRad CFX96 Touch Real-Time PCR System (Bio-Rad Laboratories ...
-
bioRxiv - Cell Biology 2024Quote: ... Real-time PCR reactions were carried out using SYBR green Master Mix on a CFX96 Real Time system (BIO-RAD). Primer sequences are provided in the following table ...
-
bioRxiv - Microbiology 2023Quote: ... Real-time PCR was performed using the iTaqUniversal SybrGreen one-step kit (BioRad, Hercules, Ca, USA) according to the manual protocol ...
-
bioRxiv - Genetics 2023Quote: ... Real-time PCR was conducted with the iTaq Universal SYBR Green Supermix kit (Bio-Rad, 1725121) using the manufacturer’s protocol and reaction parameters for the QuantStudio3 (Applied Biosystems) ...
-
bioRxiv - Immunology 2023Quote: ... Then gene expression was determined by SYBR green real-time PCR using SYBRTM Premix kit (BioRad) and was expressed using the 2 -ΔΔCt method ...
-
bioRxiv - Cancer Biology 2024Quote: ... Quantitative real-time PCR was performed using manufacturers’ instructions for SSO advanced SYBR green kit (Biorad) on ABI-qPCR system using equal amount of template (50–100 ng cDNA ...
-
bioRxiv - Neuroscience 2021Quote: ... qRT-PCR was performed using iQ™ SYBR®Green Supermix on an iQ™5 multicolor real-time PCR detection system (Bio-Rad, CA, USA). All primers were obtained from Sigma-Aldrich and described in Suppl ...
-
bioRxiv - Molecular Biology 2020Quote: ... ATGATAGTAGAGTTGAGTAGCG) and nuclear (GTACCCACCTGTCGTCC, GTCCACGAGACCAATGACTG) genes 105 were used for qPCR on CFX Connect™ Real-Time PCR Detection System (Bio-Rad). Mitochondrial to nuclear DNA ratios were quantified using the ΔΔCt method.
-
bioRxiv - Cell Biology 2020Quote: ... qPCR was run using the SYBR® Green Master Mix on a CFX Connect™ Real-Time PCR Detection System (Bio-Rad). Gene expression was relative to the housekeeping gene Gapdh or Hprt and presented by 2-△Ct 52.
-
bioRxiv - Molecular Biology 2020Quote: ... QPCR was performed using Precision Melt Supermix containing EvaGreen dye (cat# 172-5110) using CFX96 Touch™ Real-Time PCR Detection System (BioRad, USA). Sequences of PCR primers are listed in Table.
-
bioRxiv - Physiology 2020Quote: ... All RTqPCR reactions were performed in triplicate using TaqMan probes™ in combination with CFX96 Touch™ Real-Time PCR Detection System (BioRad), paired with CFX Maestro™ Analysis Software.
-
bioRxiv - Plant Biology 2019Quote: ... see Table S1 for primer sequences) and was performed using a CFX Connect Real-Time PCR Detection System (Bio-Rad, Watford, UK) with 40 cycles of 95°C-10s ...
-
Glutathione S-transferase: A Candidate Gene for Berry Color in Muscadine Grapes (Vitis rotundifolia)bioRxiv - Genetics 2020Quote: ... Gene transcript levels were measured by qPCR using a CFX96 Touch Real-Time PCR Detection System (Bio-Rad Laboratories Inc., Hercules, CA). All qPCR reactions were carried out in triplicate and expression for the three genes was normalized against VvUbiquitin (Bogs 2005).
-
bioRxiv - Cancer Biology 2020Quote: ... Quantitative PCR was then performed using the Bio-Rad iTaq™ universal SYBR® Green supermix and analysed using a CFX96TM real-time PCR detection system under the CFX Manager software (Bio-Rad). Gene expression was normalized to hypoxanthine-guanine phosphoribosyltransferase (HPRT) ...
-
bioRxiv - Plant Biology 2020Quote: ... qPCR was performed with the PerfeCTa SYBR Green SuperMix (Quantabio, USA) in a CFX Connect Real-Time PCR Detection System (Bio-Rad, USA).
-
bioRxiv - Plant Biology 2021Quote: ... The PowerUp™ SYBR® Green fluorescence dye was used for quantitative gene expression analysis on CFX connect Real-time PCR detection system (Bio-Rad). The details of genes used for expression analysis and the primers are presented in Supplementary Table S3 and S4 ...
-
bioRxiv - Microbiology 2022Quote: ... The melt curve analysis was performed at 65°C for 1 minute in CFX connects TM Real-time PCR detection system (Bio-Rad, USA). The primers used are listed inTable 1 ...
-
bioRxiv - Molecular Biology 2020Quote: ... qPCR was performed using the Thermo-Scientific SyBr Green Maxima Mix and the MyiQ2 Two-Color Real-Time PCR Detection System (Bio-Rad Laboratories). Primers that specifically amplify mtDNA are listed in Supplementary table 5 ...
-
bioRxiv - Neuroscience 2021Quote: ... SYBR ROX green qPCR reactions were performed in triplicate and data were collected using a BioRad CFX Connect Real-Time PCR Detection System (BioRad, Hercules, CA). Reactions were denatured at 95°C for 10 min then subjected to 95° C for 15 sec and 60° C for 1 min for 40 cycles ...
-
bioRxiv - Neuroscience 2020Quote: ... we performed qPCR using the CFX Connect Real-Time PCR Detection System with iTaq Universal SYBR Green Supermix (Bio-Rad, Hercules, CA). The qPCR primers are described in Table 1.
-
bioRxiv - Genetics 2019Quote: ... Quantitative PCR data was produced on a Bio-Rad CFX96 Real-Time PCR Detection System with iTaq Universal SYBR Green Supermix (Bio-Rad, #1725121) reagent using a forward primer unique to cloned ORFeome genes (5’-GGGGACAAGTTTGTACAAAAAAGCAGGCT ...
-
bioRxiv - Genetics 2020Quote: ... Quantitative PCR data was produced on a Bio-Rad CFX96 Real-Time PCR Detection System with iTaq Universal SYBR Green Supermix (Bio-Rad, #1725121). A forward primer anneals to the attb1 site (5’-GGGGACAAGTTTGTACAAAAAAGCAGGCT ...
-
bioRxiv - Microbiology 2020Quote: ... All qPCR amplifications were carried out as technical duplicates on a CFX96 Real-Time PCR Detection System (Bio-Rad, Hercules, CA, USA). Additional thermal cycling conditions and standards are described in the supplemental methods.
-
bioRxiv - Cell Biology 2019Quote: ... which was performed using a 2 μl cDNA /20 μl reaction volume on a CFX Connect™ real-time PCR detection system (Bio-Rad) using SYBR Green according to the manufacturer’s protocol ...
-
bioRxiv - Pathology 2021Quote: ... in a Real-Time PCR Easy (SYBR Green I) (HY-K0501, MCE, China) on Bio-RAD Sequence Detection system (Bio-RAD, USA). The following primers were used in Supplemental Table 5 ...
-
bioRxiv - Microbiology 2019Quote: ... The qPCR with primers specific for the biocontrol agent and the fungal community was carried out on a CFX Connect™ Real-Time PCR Detection System (Bio-Rad).
-
bioRxiv - Biochemistry 2019Quote: ... Quantification of Superscript™ III generated cDNA was performed using an iCycler with an iQ5 multicolor real-time PCR detection system (Bio-Rad). Triplicate cDNA’s were analyzed and normalized to Asf I cDNA ...
-
bioRxiv - Cancer Biology 2021Quote: ... according to the manufacturer’s instructions in a MyiQ™2 Two-Color Real-Time PCR Detection System (Bio-Rad, Veenendaal, The Netherlands).
-
bioRxiv - Physiology 2021Quote: ... were used for real-time PCR with gene-specific primers (Supplemental Table 1) and Tbp as a house keeping gene on a CFX96™ Real-Time PCR Detection System (Bio-Rad).
-
IL-27R signaling serves as immunological checkpoint for NK cells to promote hepatocellular carcinomabioRxiv - Immunology 2020Quote: ... Q-RT-PCR was performed with Bio-Rad CFX 96 Connect Real-Time PCR Detection System using iTaq Universal SYBR Green Supermix (Bio-Rad, 1725124). The following primers were used ...
-
bioRxiv - Bioengineering 2021Quote: The gene abundances of conventional autotrophic nitrifiers (AOB and NOB) were determined by qPCR using the CFX real-time PCR detection system (Bio-Rad, USA). The primer set of amoA gene of AOB was amoA-1F/2R (Rotthauwe et al. ...
-
bioRxiv - Physiology 2023Quote: Quantitative PCR was performed with TOPreal™ qPCR 2X premix (Enzynomics, Daejeon, Korea) and CFX96 Touch Deep Well Real-Time PCR Detection System (Bio-Rad). The following condition was used ...
-
bioRxiv - Biochemistry 2022Quote: ... GAPDH expression was used for normalizing relative gene expression calculated by the ΔΔCt quantification method using a CFX96 Touch Real-Time PCR detection system (Bio-Rad Laboratories). An unpaired ...
-
bioRxiv - Microbiology 2022Quote: ... and amplified using 2×TSINGKE master qPCR mix (Tsingke, Beijing, China) using specific primers designed for quantitative analysis in CFX96 Real-Time PCR Detection System (Bio-Rad, USA). Amplification was conducted for cycles of 95℃ for 10 s ...
-
bioRxiv - Neuroscience 2023Quote: ... followed by SARS-CoV-2 qRT-PCR using the Seegene Allplex™ 2019-nCoV Assay (cat. no: RP10243X) on a CFX96 Real-time PCR Detection System-IVD (Bio-Rad)
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... using a Sso Advanced Universal SYBR Green Supermix in a Bio-Rad CFX384 Real-Time PCR Detection System (Bio-Rad, Hercules, CA). Data were normalized to the housekeeping gene Glyceraldehyde 3-phosphate dehydrogenase (Gapdh ...
-
bioRxiv - Plant Biology 2023Quote: ... The relative level of the NlCA transcript was quantified using a CFX96TM Real-Time PCR Detection System (Bio-Rad, Hercules, CA, USA) with primers shown in Supplementary Table 1 ...
-
bioRxiv - Immunology 2023Quote: Gene mRNA expression was determined by using primers in Table S1 with a CFX Connect Real-Time PCR Detection System (Bio-Rad Laboratories) following reverse transcription with SuperScript Reverse Transcriptase (18064022 ...
-
bioRxiv - Bioengineering 2023Quote: The gene abundance of total bacteria and nitrifiers were determined by the quantitative polymerase chain reaction (qPCR) using the CFX real-time PCR detection system (Bio-Rad, USA). The primer sets chosen for AOB ...
-
bioRxiv - Biochemistry 2023Quote: ... were obtained using differential scanning fluorimetry (DSF).44 Experiments were performed on CFX96 Touch™ Real-Time PCR Detection System (Bio-Rad). SsoPox variants were used at 1 mg.mL-1 in Tris buffer (50 mM Tris-HCl ...
-
bioRxiv - Physiology 2024Quote: ... were used for real-time PCR with gene-specific primers (Supplementary Table 4) and Tbp as a housekeeping gene on a CFX96™ Real-Time PCR Detection System (Bio-Rad).
-
bioRxiv - Cell Biology 2024Quote: ... The cDNA obtained was analyzed by quantitative polymerase chain reaction (qPCR) using the CFX96 real-time PCR detection system (Bio-Rad Laboratories). The PCRs were performed in 20 µl reaction volumes that included 50 mM Tris–HCl (pH 8.6) ...
-
bioRxiv - Immunology 2019Quote: ... IFN or inflammatory cytokine mRNA expression levels were measured using quantitative RT-PCR on a CFX96 real-time system (BioRad, Hercules, CA); the two-temperature cycle of 95 °C for 15 s and 60 °C for 1 min (repeated for 40 cycles ...
-
Characterization of GRK5 as a novel regulator of rhabdomyosarcoma tumor cell growth and self-renewalbioRxiv - Cancer Biology 2019Quote: ... RT-PCR reactions were then run with iTaq Universal SYBR Green mix on a CFX Connect Real Time System (BioRad, Hercules, CA). RT-PCR primers used are listed below:
-
bioRxiv - Neuroscience 2020Quote: ... levels were quantified by real time polymerase chain reaction (RT-PCR) using SYBR® Green DNA intercalating dye and master mix (Bio-Rad) and the ABI 7900HT PCR machine ...
-
bioRxiv - Neuroscience 2021Quote: ... Selected genes were validated with reverse transcription and real-time PCR (RT-qPCR) with SYBR Premix on Bio-Rad CFX 96 (Bio-Rad Inc.), according to the manufacturer’s instructions ...