Labshake search
Citations for Bio-Rad :
1901 - 1950 of 9153 citations for Onion Yellow Dwarf Virus OYDV PCR Kits since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: ... QPCR was performed on a CFX96 real-time PCR thermocycler (Bio-Rad) using the SYBR-Green PCR Master Mix (Bio-Rad) ...
-
bioRxiv - Cancer Biology 2022Quote: ... and Bio-Rad CFX96 touch Real-Time PCR detection system (Bio-Rad). mRNA levels were normalized to their corresponding GAPDH expression levels ...
-
bioRxiv - Immunology 2022Quote: ... and methylation-specific quantitative PCR using iQTM SYBR Green Supermix (Bio-Rad) (32) ...
-
bioRxiv - Immunology 2022Quote: ... RT-PCR was performed using the SsoAdvanced Universal SYBR Green Supermix (BioRad) and the primers for murine IFNAR 1 and beta-Actin in a MyiQ™ Single-Color Real-Time PCR System (BioRad) ...
-
bioRxiv - Neuroscience 2022Quote: ... on a CFX96 Touch™ Real-Time PCR Detection System (Bio-Rad). Logarithmic regression was used to plot Ct values against a known number of copies and absolute mtDNA copies number for each sample was calculated as previously described (Gonzalez-Hunt et al. ...
-
bioRxiv - Immunology 2022Quote: ... Quantitative PCR was performed using SsoAdvanced Universal SYBR Green Supermix (Bio-Rad) on CFX96 Real-Time PCR Detection System (Bio-Rad) ...
-
bioRxiv - Developmental Biology 2022Quote: ... RT-PCR was performed using iTaq Universal SYBR green supermix (Bio-Rad). Mouse primer sequences are as follows ...
-
bioRxiv - Bioengineering 2022Quote: ... Quantitative real time PCR was performed using SsoFast EvaGreen Supermix (Bio-Rad) or PowerUp SYBR Green Master Mix (Thermo Fisher ...
-
bioRxiv - Developmental Biology 2022Quote: ... on CFX96 Real-Time PCR Detection System (C1000 Thermal Cycler, Bio-Rad). All primers used in this study are listed in Table EV1.
-
bioRxiv - Developmental Biology 2022Quote: ... qRT-PCR was carried out on a CFX96 Touch qPCR System (BioRad) using iQ Supermix (BioRad) ...
-
bioRxiv - Microbiology 2022Quote: ... on a CFX96 Touch Real-Time PCR Detection System (Bio-Rad, 1855195). Primer sequences can be found in Supplemental Table 1.
-
bioRxiv - Molecular Biology 2022Quote: ... PCR amplifications were performed using a T100 Thermal Cycler (Bio-Rad, USA) under the following conditions ...
-
bioRxiv - Microbiology 2022Quote: ... and the QX200 Droplet Digital PCR System Workflow (Bio-Rad Laboratories Ltd). ddPCR primers and probes are listed in the supplementary table 2.
-
bioRxiv - Immunology 2022Quote: ... The real-time PCR was performed on a MyiQTM System (BioRad, USA) in a reaction-volume of 25 µl with 12.5 µl iQTM SYBR Green (Biorad) ...
-
bioRxiv - Biophysics 2022Quote: ... pH 7.4 were set up in 96-well PCR plates (Bio-Rad), sealed with a microseal B adhesive sealer (Bio-Rad ...
-
bioRxiv - Bioengineering 2022Quote: ... qRT–PCR was performed by a CFX Connect Real-Time System (BIORAD) using KOD SYBR qPCR Mix (QKD-201 ...
-
bioRxiv - Bioengineering 2022Quote: ... qRT-PCR was performed on the CFX96 Real-Time System (Bio-Rad) for 40 cycles ...
-
bioRxiv - Cancer Biology 2022Quote: ... Quantitative PCR (qPCR) was performed using CFX96 Real-Time System (Bio-Rad). Reactions (10 µl each ...
-
bioRxiv - Developmental Biology 2022Quote: ... RT-PCR was performed using iTaq Universal SYBR Green Master Supermix (BioRad) and CFX384 Touch Real-Time PCR Detection System (Bio-Rad) ...
-
bioRxiv - Cancer Biology 2022Quote: ... qRT-PCR was performed with iTaq Universal SYBR Green Supermix (Bio-Rad). Primers span an exon-exon junction and were designed with Primer-BLAST (NCBI) ...
-
bioRxiv - Developmental Biology 2022Quote: ... and the iQ™5 Real-Time PCR Detection System from BioRad according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2022Quote: ... and the CFX96 Touch Real-Time PCR Detection System (Bio-RAD, 1855196). Changes in gene expression levels were determined relative to the housekeeping gene RPLP0 (5′- CTCTGCATTCTCGCTTCCTGGAG -3′ and 5′- CAGATGGATCAGCCAAGAAGG -3′ ...
-
bioRxiv - Neuroscience 2021Quote: ... in CFX384 Touch™ Real-Time PCR Detection Systems (Bio-Rad Laboratories). To normalize the expression data ...
-
bioRxiv - Neuroscience 2021Quote: ... and specific primers in a C1000 Touch PCR thermal cycler (Bio-Rad). Gapdh and β-actin mRNA levels were used as an endogenous control for normalization using the ΔCt method (70) ...
-
bioRxiv - Plant Biology 2021Quote: ... Real-time PCR was performed using the SYBR Green Master Mix (BioRad) with the SYBR Green fluorophore and a CFX Connect Real Time PCR Detection System (BioRad) ...
-
bioRxiv - Cancer Biology 2021Quote: ... samples were quantified on a CFX96 real-time PCR instrument (Bio-Rad) using a Qubit BR Assay Kit (Thermo Fisher) ...
-
bioRxiv - Neuroscience 2020Quote: ... on a CFX96 Real-Time PCR Detection System (Cat# 1855195, Bio-Rad). The following primers were used ...
-
bioRxiv - Neuroscience 2020Quote: RT-PCR was performed using SYBR green detection master mix (BioRad 430001607) and amplification was normalized to expression levels of Gapdh for each sample ...
-
bioRxiv - Neuroscience 2020Quote: ... in a MyiQ Single Color Real-Time PCR Detection System (Bio-Rad), with each reaction performed at a 20 μl sample volume in an iCycler iQ PCR 96-well Plate (Bio-Rad ...
-
bioRxiv - Cell Biology 2021Quote: ... or quantitative PCR (qPCR) using iTaq Universal SYBR Green Supermix (Bio-Rad). Primers ...
-
bioRxiv - Developmental Biology 2020Quote: ... Quantitative PCRs were performed using iTaq Universal SYBR® Green Supermix (BioRad) on the StepOnePlus™ RT PCR system ...
-
bioRxiv - Molecular Biology 2020Quote: qRT-PCR was operated on ABI Prism 7500 Sequence Detection System (BioRad, Life Science Research ...
-
bioRxiv - Cell Biology 2020Quote: ... using the CFX Connect Real Time PCR System (Bio-Rad, Hercules, CA). Primers were used at a concentration of 300 nM ...
-
bioRxiv - Cell Biology 2021Quote: ... qPCR was conducted using CFX Connect Real-Time PCR Detection System (BioRad). All qPCR data was normalized to GAPDH and RPL13 which are used as housekeepers ...
-
bioRxiv - Microbiology 2020Quote: ... qRT-PCR was performed on a CFX96 Real-Time System (Bio-Rad), using SsoFast Evergreen Supermix (Bio-Rad ...
-
bioRxiv - Physiology 2021Quote: ... PCR amplification was carried out on a T100 thermal cycler (Bio-Rad) using a thermal profile beginning at 95°C for five minutes ...
-
bioRxiv - Microbiology 2020Quote: ... qRT-PCR reactions were run in a 384 well plate (Bio-Rad) using CFX384 Real-Time System (Bio-Rad) ...
-
bioRxiv - Microbiology 2020Quote: ... the QX200 Droplet Digital PCR System from Bio-Rad (Hercules, CA, USA) was used ...
-
bioRxiv - Physiology 2021Quote: ... Real-time PCR was conducted with SsoAdvance Universal SYBR Green (Bio-Rad) using a QuantStudio 6 Flex Real-Time PCR System (Thermo Fisher) ...
-
bioRxiv - Microbiology 2021Quote: ... and plates were sealed with the PX1 PCR Plate Sealer (Bio-Rad) before proceeding with RT-PCR on the C1000 Touch Thermal Cycler (Bio-Rad ...
-
bioRxiv - Cancer Biology 2021Quote: ... Quantitative RT-PCR was performed with SYBR Green Master Mix (Bio-Rad) on a Bio-Rad real-time PCR system ...
-
Histone H3K36me2-specific methyltransferase ASH1L is required for the MLL-AF9-induced leukemogenesisbioRxiv - Cancer Biology 2021Quote: ... and detected by CFX386 Touch Real-Time PCR detection system (Bio-Rad). Primer sequences for qPCR are listed in Supplementary Table 5 The expression of individual genes is normalized to expression level of Gapdh ...
-
bioRxiv - Microbiology 2022Quote: ... and PCR amplification was performed in the presence of SYBR Green (BioRad) in a CFX96 real-time PCR detection system (BioRad) ...
-
bioRxiv - Cell Biology 2022Quote: ... and the CFX Connect real-time PCR machine (Bio-Rad, Hercules, CA). The primer information is shown in the Key Resources Table ...
-
bioRxiv - Immunology 2022Quote: ... Quantitative PCR was performed using iTaq Universal SYBR Green Supermix (Bio-Rad) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2022Quote: ... cells were sorted single-cell in 384-wells PCR plates (Biorad, USA) containing 100 nl water containing 7.5 ng/μl unique Cellseq-2 primers (Table S6 ...
-
bioRxiv - Cancer Biology 2022Quote: ... and the PCR reaction was performed with a CFX cycler (Bio-Rad). Data analysis comparing ΔCT values normalized to a reference gene (β-actin ...
-
bioRxiv - Neuroscience 2022Quote: ... and a CFX96 Touch Real-Time PCR Detection System (Bio-Rad, Canada). Hippocampal and jejunal samples were analyzed in triplicates ...
-
bioRxiv - Genetics 2020Quote: ... and detected by CFX386 Touch Real-Time PCR detection system (Bio-Rad). Primer sequences for qPCR are listed in Supplementary Table 3.
-
bioRxiv - Biochemistry 2020Quote: ... Quantitative RT-PCR was performed in a CFX96 Touch thermocycler (Bio-Rad) using PowerUp SYBR Green Master mix (Invitrogen ...