Labshake search
Citations for Bio-Rad :
1901 - 1950 of 4102 citations for Human Complement C3 Convertase C3c CLIA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Physiology 2023Quote: ... cDNA was prepared using iScript Reverse Transcription Supermix for RT-qPCR kit (Bio-Rad) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2023Quote: ... iTaq™ Universal SYBR® Green Supermix kit (cat. #1725124, Bio-Rad Laboratories Ltd.) was used according to the manufacturer’s recommendation with cDNA (diluted 1:10∼20 ...
-
bioRxiv - Cancer Biology 2023Quote: ... and 1 μg was reverse transcribed using the iScript cDNA Synthesis kit (Bio-Rad). Real-time quantitative RT– PCR was performed on a LightCycler 2.0 apparatus (Roche ...
-
bioRxiv - Neuroscience 2023Quote: ... cDNA was reverse transcribed using iScript cDNA Synthesis Kit (Bio-Rad; Hercules, CA, USA), according to the manufacturer’s protocol using 1 µg total RNA in 20-µL reactions.
-
bioRxiv - Physiology 2023Quote: ... Protein concentrations were determined using a standard Bradford Colorimetric Assay kit (Bio-Rad, 5000116). Proteins were separated by SDS-PAGE and transferred to 0.45µm nitrocellulose membranes ...
-
bioRxiv - Physiology 2023Quote: ... Protein concentration was measured using the DC Protein Assay Kit II (5000112, Bio-Rad) following manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... RT-PCR was performed using the iScript cDNA Reverse Transcription Supermix Kit (Bio-Rad), following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... qPCR was performed using the iTaq Universal SYBR green qPCR Kit (Biorad, California, US), and the program used was set as follows ...
-
bioRxiv - Biochemistry 2023Quote: cDNA was prepared with the help of iScript gDNA clear cDNA synthesis kit (Biorad). cDNA was added to iTaq Universal SYBR Green Supermix and gene specific primers ...
-
bioRxiv - Immunology 2023Quote: ... Protein concentrations were determined and normalized using the DCA Protein Assay kit (Bio-Rad). Clarified lysates (5 min × 5,000 g ...
-
bioRxiv - Cell Biology 2023Quote: ... RNA was reverse transcribed using iScript™ cDNA Synthesis Kit (BioRad, Hercules, CA, USA). One hundred nanograms of cDNA were amplified in duplicates in each 40-cycle reaction using a CFX 384 Real Time PCR System (BioRad ...
-
bioRxiv - Immunology 2023Quote: ... and reverse-transcribed into cDNAs using cDNA iScriptTM advanced cDNA synthesis kit (Bio-Rad). Duplex ddPCR reactions were performed by combining cDNA products with human IL-1α ...
-
bioRxiv - Neuroscience 2024Quote: ... Proteins were revealed using an enhanced chemiluminescence kit (1705061 Bio-Rad, Hercules, California, USA) and the imaging system LAS-4000 mini (GE HealthCare Technologies Inc. ...
-
bioRxiv - Cancer Biology 2024Quote: ... Reverse transcription was performed with iScript™ Advanced cDNA Synthesis Kit (BioRad, NSW, Australia) and the PCR was performed with PrimePCR SYBR® Green Assays (BioRad ...
-
bioRxiv - Neuroscience 2023Quote: ... Protein concentration was measured using a RC-DC kit (Biorad Lab., Hercules, CA, USA) according to the manufacturing protocol ...
-
bioRxiv - Immunology 2024Quote: RNA from 5×10^6 splenocytes was extracted with the RNeasy Mini Kit (BioRad) and converted to cDNA using the Maxima First Strand cDNA Synthesis Kit (ThermoFisher Scientific) ...
-
bioRxiv - Physiology 2023Quote: ... supernatant was retained and protein quantified with the DC Protein assay kit II (Biorad). Proteins samples (1.5µg and 3µg of proteins ...
-
bioRxiv - Cell Biology 2024Quote: ... whose concentrations were measured using the DC Protein Assay Kit (Lowry method, BioRad, 5000116), following the instructions provided by the manufacturer.
-
bioRxiv - Neuroscience 2024Quote: ... cDNA synthesis was performed using the iScript cDNA Synthesis kit (Bio-Rad, #170-8891). qRT-PCR was performed in triplicate on a CFX384 Real Time System C1000 Thermal Cycler (Bio-rad ...
-
bioRxiv - Cell Biology 2024Quote: ... cDNA was generated from 1ug RNA using iScript reverse transcription kit (Bio-Rad, #1708891) and diluted 1:3 in water ...
-
bioRxiv - Cell Biology 2024Quote: ... cDNA synthesis was then performed using reverse transcription kits (Bio-Rad Laboratories, Hercules, CA). qPCR was carried out with TaqMan® probe/primers (Applied Biosystems ...
-
bioRxiv - Cell Biology 2024Quote: ... and then transcribed into cDNA using the iScript™ cDNA Synthesis Kit (Bio-Rad), following the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2024Quote: ... The complementary DNA was synthesized using iScript cDNA synthesis kit (Bio-Rad, #1708891, USA), according to the manufacturers’ protocol ...
-
bioRxiv - Bioengineering 2024Quote: ... Protein concentrations were determined by Bradford protein assay reagent kit (BIO-RAD, Hercules, CA). Visible GFP bands in the Comassie Blue Stained protein gels were quantified with 1D-Multi lane densitometry (Alpha Innotech Alphaimager 2200 ...
-
Genomic dissection and mutation-specific target discovery for breast cancer PIK3CA hotspot mutationsbioRxiv - Genomics 2024Quote: ... RNA was converted to cDNA using the iScript cDNA Synthesis Kit (Bio-rad, 1708890). qPCR was performed using the AREG and ACTB qPCR primer sets (Table S5 ...
-
Genomic dissection and mutation-specific target discovery for breast cancer PIK3CA hotspot mutationsbioRxiv - Genomics 2024Quote: ... RNA was converted to cDNA using the iScript cDNA Synthesis Kit (Bio-rad, 1708890). qPCR was performed using the AREG and ACTB qPCR primer sets (Table S5 ...
-
bioRxiv - Cell Biology 2024Quote: ... Total RNA was reverse transcribed to cDNA using the iScript Advanced cDNA kit (Biorad) according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... treated with Turbo DNase and converted to cDNA using iScript cDNA synthesis kit (BioRad). Gene expression was quantified using iTaq Universal SYBR Green (BioRad ...
-
bioRxiv - Biochemistry 2024Quote: ... The cDNA was prepared by following manufacture’s instruction (iScript select cDNA synthesis kit, BioRad). The GNL primers (GTTTGGAGA CAATGATGGCGT/TCCCGTTCCAGCGAGAGTAAC ...
-
bioRxiv - Developmental Biology 2024Quote: ... Conversion into cDNA was performed using reverse transcription (iScript cDNA Synthesis Kit; Bio-Rad Laboratories ...
-
bioRxiv - Microbiology 2020Quote: ... The RNA was reverse transcribed into cDNA using an iScript cDNA synthesis kit (Bio-Rad) following the manufacturer’s instruction.
-
bioRxiv - Genetics 2020Quote: ... quantitated and 1 μg of RNA reverse transcribed into cDNA using iScript kit (Bio-Rad). Three overlapping MTM1 cDNAs were amplified using three pairs of cDNA primers from Tosch et al(Tosch et al ...
-
bioRxiv - Cancer Biology 2021Quote: ... RNA reverse transcription was done using the iScript cDNA synthesis kit (Bio-Rad Laboratories, 1708891) according to the manufacturer’s directions ...
-
bioRxiv - Cell Biology 2020Quote: ... 1 µL cDNA was used to perform qPCR using SsoAdvanced SYBR Green supermix kit (BioRad) on a CFX96 machine (BioRad) ...
-
bioRxiv - Cell Biology 2020Quote: ... cDNA was generated from 1 μg mRNA using iScript reverse transcription kit (Bio-Rad, #1708891) and diluted 1:3 in water ...
-
bioRxiv - Immunology 2021Quote: ... Total RNA was reverse transcribed to cDNA using iScript cDNA Synthesis Kit (Bio-Rad, UK) according to the manufacturer’s instructions ...
-
bioRxiv - Genetics 2021Quote: ... RNA was reverse-transcribed using an iScript cDNA synthesis kit (Bio-Rad, Des Plaines, IL). Assay of RNA via quantitative PCR [qPCR] was performed with iTaq universal SYBR green supermix (Bio-Rad) ...
-
bioRxiv - Genetics 2020Quote: ... Total RNA was converted to cDNA using the iScript cDNA synthesis kit (1708891, Bio-Rad). We performed transcript-specific PCRs using the following primers and conditions ...
-
bioRxiv - Genetics 2020Quote: ... We synthesized cDNA using Bio-Rad iScript Reverse Transcription Supermix kit (Bio-Rad, 170-8891). We amplified hmx1 sequence from the cDNA using Phusion High-Fidelity DNA Polymerase (M0530L ...
-
bioRxiv - Microbiology 2021Quote: ... One microgram from each sample was reverse transcribed using an iScript cDNA Synthesis Kit (BioRad). RT-qPCR was then performed using gene-specific primers (Table S1 ...
-
bioRxiv - Molecular Biology 2021Quote: ... Two µg of RNA was reverse transcribed using the iScript cDNA synthesis kit (Bio-Rad) to synthesize cDNA ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... RNA integrity and concentration were determined using Experion RNA StdSens analysis kit (BioRad, Hercules, USA). Total RNA was DNase treated (TurboDNase ...
-
bioRxiv - Immunology 2020Quote: ... cDNA was synthesized using the iScript gDNA Clear cDNA Synthesis kit (1725035, Bio-Rad, USA) and a Bio-Rad C1000 Touch ThermoCycler (Bio-Rad) ...
-
bioRxiv - Immunology 2020Quote: ... RNA (700 ng) was reverse transcribed using iScript cDNA synthesis kit (Biorad, Hercules, CA, USA). The cDNA obtained was used for subsequent real-time quantitative qPCR reactions (CFX96 Thermal Cycler ...
-
bioRxiv - Developmental Biology 2020Quote: ... Protein concentration was measured with an RC DC protein assay kit (Bio-Rad; Feldkirchen, Germany). 10 μg protein per sample was loaded ...
-
bioRxiv - Neuroscience 2021Quote: ... qRT-PCR was performed by using Sso-Advanced Universal SYBR Green Supermix Kit (Bio-Rad) on CFX96 Real-Time System (Bio-Rad) ...
-
bioRxiv - Molecular Biology 2021Quote: ... and cDNA was synthesized for each RNA fraction using the iScript cDNA synthesis kit (BioRad). RT-qPCR was then performed for total and newly transcribed fractions and used to determine the relative transcription rate of genes of interest ...
-
bioRxiv - Molecular Biology 2021Quote: ... Lysate protein concentration was determined using DC Protein Assay Kit II (cat# 5000112, Bio-Rad). Equivalent amounts of protein ...
-
bioRxiv - Molecular Biology 2020Quote: ... Protein concentration of VSW-3 RNAP was determined by Bradford protein quantitative kit (Bio-rad), and protein purity and concentration were analyzed along with T7 RNAP (New England Biolabs ...
-
bioRxiv - Molecular Biology 2020Quote: ... and chloroform and 2μg was reverse transcribed using the iScript cDNA Synthesis Kit (Bio-Rad). Resulting cDNAs were used to assay gene expression via real-time PCR using the following gene-specific primers ...