Labshake search
Citations for Bio-Rad :
1751 - 1800 of 7200 citations for Peroxidase Microplate Assay Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2021Quote: ... Protein concentrations were determined using DC Protein Assay (Bio-Rad). Equivalent amounts (10-50 µg ...
-
bioRxiv - Cancer Biology 2021Quote: ... Protein concentrations were determined using DC Protein Assay (Bio-Rad). Equivalent amounts (1mg ...
-
bioRxiv - Microbiology 2022Quote: ... Total protein concentration was determined using the Bradford assay (Biorad). To detect LexA-FLAG or LexA abundance in cell lysates ...
-
bioRxiv - Neuroscience 2022Quote: ... measured using the Bradford protein assay (Bio-Rad, Watford, UK).
-
bioRxiv - Cell Biology 2022Quote: ... Protein concentration of sample was determined (DC protein assay, Biorad) before aliquoting and flash freezing samples in liquid nitrogen ...
-
bioRxiv - Cell Biology 2022Quote: Protein concentrations were determined by DC assay (BioRad, Hercules, USA). Samples with equal amounts of protein were mixed with a 1:1 mixture of 4x NuPAGE LDS Sample Buffer (Invitrogen ...
-
bioRxiv - Neuroscience 2019Quote: ... Protein was quantified using a standard Bradford assay (Bio-Rad) and 20ug of protein per sample were run on 10% SDS-Page gels ...
-
bioRxiv - Immunology 2019Quote: ... Total protein was quantified using the DC assay (Bio-Rad.) and resolved on a TGXTM FastCastTM Acrylamide gels (Bio-Rad) ...
-
bioRxiv - Cancer Biology 2019Quote: ... Samples were then equalized using the Bradford protein assay (Biorad), and incubated with the indicated antibody ...
-
bioRxiv - Biochemistry 2019Quote: ... and concentrations were measured using the Bradford assay (Bio-Rad) or using A280 with extinction coefficients calculated by ProtParam (SIB ExPASy Bioinformatics Resource Portal).
-
bioRxiv - Pathology 2020Quote: ... Protein concentrations were determined using the Bradford assay (Bio-Rad) or BCA assay ...
-
bioRxiv - Genomics 2020Quote: ... Lysate protein concentrations were normalized by Bradford assay (Bio-Rad). Proteins were then denatured by the addition of sample buffer and by boiling for 5 minutes ...
-
bioRxiv - Immunology 2019Quote: ... Protein concentration was measured using the Bradford assay (Bio-Rad) and total protein (20-25 μg ...
-
bioRxiv - Cell Biology 2019Quote: Protein concentration was determined by DC Protein assay (5000111, Biorad) according to manufacturer’s instructions.
-
bioRxiv - Plant Biology 2020Quote: ... determined using the Quick Start Bradford Protein Assay (Bio-Rad) following manufacturer’s instruction.
-
bioRxiv - Immunology 2019Quote: ... or RasGRP1 (PrimePCR SYBR Green Assay RasGRP1 human, Bio-Rad, amplicon context sequence GGTTCCTTGGTTCCCGGGCATAGGAAAGCTCATAGATTTCATCCTCAGTGTAGTAAAGAT CCAGGGATAACGTCAGCAAGTGTACCAAGTCCTTGTTAGCCTCCAAGG (exon 10) ...
-
bioRxiv - Molecular Biology 2019Quote: ... Proteins were quantified using the DC Protein Assay (Bio-Rad), separated by SDS-PAGE and transferred to 0.2 µm pore Nitrocellulose membrane (Amersham Protran ...
-
bioRxiv - Cell Biology 2020Quote: ... and subjected to Bradford assay (BIO-RAD REF# 500-0006) prior to SDS-PAGE electrophoresis on a 4-15% gradient gel (BIO-RAD REF# 456-1086) ...
-
bioRxiv - Cell Biology 2019Quote: ... Protein concentrations had been determined by BCA protein assay (Biorad). A total of 20μg of protein was separated by SDS-polyacrylamide electrophoresis using NuPAGE 7% Tris-Acetate Gel (Thermo-Fisher) ...
-
bioRxiv - Plant Biology 2020Quote: ... Mitochondrial protein was quantified using DC Protein Assay (Bio-Rad).
-
bioRxiv - Cell Biology 2019Quote: ... Protein concentrations were determined using the Bradford assay (Bio-Rad). Thirty micrograms extract was mixed with 4× sample buffer (40% glycerol ...
-
bioRxiv - Cell Biology 2020Quote: ... as determined by Bradford assay (Bio-Rad Protein Reagent Dye).
-
bioRxiv - Immunology 2020Quote: ... Protein concentrations were quantitated with a BCA assay (Bio-Rad). Eighty micrograms of protein was separated by SDS-PAGE and transferred to PVDF membranes (Millipore) ...
-
bioRxiv - Cell Biology 2020Quote: ... Bio-Plex® Multiplex Immunoassays Assay (Bio-Rad, California, USA) was performed according to manufacturer’s instruction ...
-
bioRxiv - Molecular Biology 2021Quote: ... Protein concentrations were determined using DC protein assay (Bio-Rad). Concentrations were equalized and diluted in FTA buffer (10 mM Tris-HCl pH 8.0 ...
-
bioRxiv - Cancer Biology 2020Quote: ... Protein concentrations were determined using the DC protein assay (BioRad). Proteins (20ug ...
-
bioRxiv - Genetics 2021Quote: ... Bradford protein assay used 150 μl reagent (BioRad #500-0006) diluted 1->5 with water in a 96 well flat-bottomed microtiter plate ...
-
bioRxiv - Molecular Biology 2021Quote: ... Protein concentrations were measured with Bradford assay (Bio-rad, 5000006) and then diluted in phosphate buffered saline (PBS ...
-
bioRxiv - Cell Biology 2019Quote: ... Protein extracts were normalized using the Bradford assay (Bio-Rad). Cell lysates were run on SDS-polyacrylamide gel and transferred to nitrocellulose membranes Protran BA 85 (GE Healthcare) ...
-
bioRxiv - Microbiology 2019Quote: ... Protein concentration was determined by DC assay (Biorad, CA, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2019Quote: ... Lysates were quantified using a Bradford assay (BioRad, 500-0205). 80 μg of total cell lysates were analyzed by Western blot using the following antibodies and concentrations ...
-
bioRxiv - Genetics 2021Quote: ... Equal quantities (20 μg) of protein (Bio-Rad Bradford assay) were brought to equal volumes with Laemmli buffer before boiling at 100°C for 10 min ...
-
bioRxiv - Cell Biology 2020Quote: ... Protein concentration of supernatant was measured by Bradford assay (Biorad). Samples were boiled for 10 minutes in Laemmli buffer with β-Mercaptoethanol (BioRad) ...
-
bioRxiv - Neuroscience 2021Quote: ... Protein concentrations were determined using the DC Protein Assay (BioRad). Equal protein amounts (30 µg ...
-
bioRxiv - Cell Biology 2021Quote: ... and proteins were quantified using the DC protein assay (Biorad). 20ug total proteins were loaded per lane ...
-
bioRxiv - Cancer Biology 2020Quote: ... Protein concentrations were determined with Bradford Protein Assay (Bio-Rad). Proteins (30 g ...
-
bioRxiv - Cancer Biology 2021Quote: ... Protein was quantified using the DC Protein Assay (Bio-Rad) then electrophoresed using Criterion TGX gels (Bio-Rad ...
-
bioRxiv - Neuroscience 2021Quote: ... Protein concentration was calculated with the BCA assay (Bio-Rad), and sample application buffer was added to lysates ...
-
bioRxiv - Biochemistry 2021Quote: ... Protein concentration was determined using DC Protein Assay (Bio-Rad) and absorbance read using a Tecan ...
-
bioRxiv - Biochemistry 2021Quote: ... Protein concentration was normalized by DC Protein Assay (Bio-Rad) and equal amount of protein was subjected to benzonase nuclease (Millipore Sigma ...
-
bioRxiv - Neuroscience 2020Quote: ... Protein was quantified using the DC Protein Assay (BioRad, 5000112). Western blots using 10μg of protein were performed as described below.
-
bioRxiv - Cancer Biology 2021Quote: ... Supernatant was quantified by Bradford and DC protein assay (BioRad). 25ug of sample was loaded per well on 8-12% Bis-Tris gels (BioRad ...
-
bioRxiv - Systems Biology 2021Quote: ... Protein concentration was determined using the Bradford assay (Bio-Rad). For reduction and alkylation of proteins ...
-
bioRxiv - Developmental Biology 2021Quote: ... Lysate protein concentrations were measured with Bradford assays (Bio-Rad Protein Assay Dye Reagent Concentrate ...
-
bioRxiv - Developmental Biology 2021Quote: ... 4 mg of protein (quantified by Bradford protein assay, Biorad) was collected ...
-
bioRxiv - Genetics 2021Quote: Protein concentrations were determined using the DC Protein Assay (BioRad) using a Bovine Serum Albumin standard curve ...
-
bioRxiv - Immunology 2020Quote: ... Protein concentration was quantified using a quickstart protein assay (BioRad). Proteins were resolved by SDS-PAGE on 10% Tris-Glycine gels (Invitrogen ...
-
bioRxiv - Microbiology 2020Quote: ... Protein concentrations were estimated using the Bradford assay (Bio-Rad) with BSA as standard.
-
bioRxiv - Microbiology 2020Quote: ... Protein concentrations were then quantified using Bradford assay reagent (BioRad), and 40ug of protein per sample was run on a 4-12% Tris Glycine polyacrylamide gel (Invitrogen) ...
-
bioRxiv - Microbiology 2021Quote: ... Protein concentrations were obtained using the Bradford quantification assay (BioRad). Production (mg/L ...