Labshake search
Citations for Bio-Rad :
1751 - 1800 of 7510 citations for Mouse Cell Surface Hyaluronidase CEMIP2 ELISA Kit since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... cDNA was synthesized using iScript cDNA synthesis kit (BIO-RAD) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... Samples were quantified using the SDS-compatible DC-kit (Biorad), followed by addition SDS-sample buffer containing excess DTT and boiled again at 95°C for 5 min to reduce disulphide bonds (does not affect the irreversible thioether bonds resulting from NEM treatment) ...
-
bioRxiv - Immunology 2023Quote: ... cDNA was synthesized with iScript cDNA Synthesis Kit (Bio-Rad). CDNA was diluted as appropriate for treatment ...
-
bioRxiv - Microbiology 2023Quote: ... and a protein assay kit (Bio-Rad Laboratories, Carlsbad, CA) was used to calculate the protein concentrations.
-
bioRxiv - Cell Biology 2023Quote: cDNA was synthesized using an iScript cDNA synthesis kit (BioRad). Real-time PCR was carried out on a ViiA 7 Real-Time PCR System (Thermofisher Scientific) ...
-
bioRxiv - Cell Biology 2023Quote: ... cDNA was synthetized with iScript cDNA Synthesis Kit (Bio-Rad). For selected analyses ...
-
VPS13B is localized at the cis-trans Golgi complex interface and is a functional partner of FAM177A1bioRxiv - Cell Biology 2023Quote: ... cDNA was synthesized with the iScript kit (Bio-Rad, #1708841) using 1mg of total RNA ...
-
bioRxiv - Immunology 2023Quote: cDNA was synthesized by iScript cDNA Synthesis Kit (Bio-Rad) using an extended 1h amplification ...
-
bioRxiv - Molecular Biology 2023Quote: ... Protein was quantified using the DC Assay kit (Bio-Rad) and diluted in SDS Sample Buffer (125 mM Tris pH 6.8 ...
-
bioRxiv - Pathology 2024Quote: ... 5 μl of 2X iTaq Universal probe kit (Bio-Rad), 300 nM of forward and reverse primers and 200 nM of probe (Table S5 ...
-
bioRxiv - Microbiology 2024Quote: ... and qPCR performed using iTaq Universal Probes Kit (Bio-Rad) for SARS-CoV-2 primers52 ...
-
bioRxiv - Developmental Biology 2024Quote: ... Protein concentrations were determined using the DC assay kit (BioRad) according to the manufacturer’s instructions.
-
bioRxiv - Immunology 2024Quote: ... using SYBR Green PCR Master Mix Kit (Bio-Rad Laboratories) to examine lung mRNA expression of Cxcl1 ...
-
bioRxiv - Immunology 2024Quote: ... cDNA synthesis was performed using iScript cDNA synthesis kit (BioRad) according to the manufacturer guidelines ...
-
bioRxiv - Microbiology 2024Quote: ... cDNA was synthesized using the iScript cDNA Synthesis Kit (BioRad) and qRT-PCR was performed using PCRBio SyGreen Blue Mix Lo-Rox (PCR Biosystems ...
-
bioRxiv - Microbiology 2024Quote: ... using iTaq universal Probes One-step RT-qPCR kit (BioRad) with N2 primers and probes (IDT ...
-
bioRxiv - Molecular Biology 2024Quote: ... Germany and cDNA Reverse transcription kit was procured from Biorad. Lipofectmine reagent and Drabkins reagent ...
-
bioRxiv - Microbiology 2024Quote: ... and iTaq Universal SYBR Green One-Step kit (Bio-Rad). Primers for RT-qPCR are described in Table 3.
-
bioRxiv - Cell Biology 2024Quote: ... The membrane was washed and developed using ECL kit (BioRad). Image analysis and quantification were performed using ImageLab software (BioRad).
-
bioRxiv - Cancer Biology 2024Quote: ... Protein was quantified using Bradford assay (Protein Assay Kit, BioRad) and an equal amount of total protein was loaded ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... The protein content was quantified using an RCDC kit (Biorad). Aliquots of 15 µg of proteins were reduced and alkylated ...
-
bioRxiv - Plant Biology 2024Quote: ... we extracted RNA using Aurum Total RNA Mini Kit (BioRad), according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2024Quote: ... Blots were visualized using the Immuno-Star WesternC kit (BioRad) on a BioRad Chemidoc XRS+ system ...
-
bioRxiv - Molecular Biology 2024Quote: ... Blots were visualized using the Immuno-Star WesternC kit (BioRad) on a BioRad Chemidoc XRS+ system ...
-
Adult choline supplementation in a Down syndrome model reduces co-morbidities and improves cognitionbioRxiv - Neuroscience 2024Quote: ... and cytokine levels via 23-plex kit (Bio-Rad; M60009RDPD). Plasma choline measures were measured in 20μL of plasma per animal ...
-
bioRxiv - Neuroscience 2024Quote: ... A Bradford kit was purchased from Bio-Rad (California, USA). For detailed information on the primary antibodies and reagents used in the present study ...
-
bioRxiv - Microbiology 2024Quote: ... The cDNA was synthesized with iScript cDNA Synthesis Kit (BioRad). For qPCR ...
-
bioRxiv - Immunology 2024Quote: ... Protein concentrations were determined with a Bradford assay kit (BioRad). For separation by electrophoresis ...
-
bioRxiv - Immunology 2024Quote: ... Reverse transcription was performed using iScriptTM cDNA Synthesis kits (BioRad) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2024Quote: ... complementary DNA (cDNA) prepared (iScriptTM cDNA Synthesis Kit (Bio-Rad)) ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... and reverse transcribed with iScript cDNA Synthesis kit (Bio-Rad). Partial fragments of each genes were amplified with PCR by using gene-specific primers and cloned into pCR4-TOPO TA vector (Invitrogen ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... using the iScriptTM gDNA Clear cDNA Synthesis kit (Bio-Rad). Gene expression was measured using the SsoAdvanced Universal SYBR® Green Supermix (Bio-Rad) ...
-
bioRxiv - Physiology 2024Quote: ... 1.25 µL ddPCR™ probe assay Kit (Bio-Rad Laboratories) which consist of forward (CGCAATCCTTTATTCTGTTCGA ...
-
bioRxiv - Molecular Biology 2024Quote: ... Amplicons were purified using the oligonucleotide purification kit from BioRad.
-
bioRxiv - Molecular Biology 2024Quote: ... system using iTaq Universal SYBR Green One-Step Kit (Biorad). 150 ng of total RNA was loaded ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... The qRT-PCR kits were purchased from BioRad (California, USA), and the ELISA kits were purchased from Peprotech ThermoFisher Scientific (Massachusetts ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... cDNA synthesis was conducted using the iScript kit (Bio-Rad). Gene expression was detected using cDNA as a template in a SYBR Green real-time PCR reaction on a CFX96 Touch Real-Time PCR Detection System (Bio-Rad ...
-
bioRxiv - Immunology 2024Quote: ... and cDNA was synthesized using cDNA reverse transcription kit (BioRad). The cDNA (10-20 ng ...
-
bioRxiv - Plant Biology 2024Quote: ... Signal was detected using a chemiluminescent substrate (Biorad, ECL kit).
-
bioRxiv - Bioengineering 2024Quote: ... The iScript™ gDNA Clear cDNA Synthesis kit (Bio-Rad) was used to generate cDNA ...
-
bioRxiv - Cancer Biology 2024Quote: cDNA was synthesized using the iScript cDNA synthesis kit (Biorad) and quantitative PCR was performed on StepOnePlus Real-Time PCR Systems using Power SYBR® Green master mix and following primers ...
-
bioRxiv - Cell Biology 2024Quote: ... for chemiluminescent detection (Clarity Max ECL substrate kit, Bio-Rad). The raw images were exported and analysed in FIJI.
-
bioRxiv - Bioengineering 2020Quote: ... Cell density and viability were measured using trypan blue and an automated cell counter (TC20, Bio-Rad).
-
bioRxiv - Bioengineering 2020Quote: ... Cells were washed with 0.5% BSA/PBS and analyzed by flow cytometry (Bio-Rad ZE5 Cell Analyzer). Binding affinity (IC50 ...
-
bioRxiv - Microbiology 2021Quote: ... Cell viability was determined using trypan blue exclusion on TC20 automated cell counter (BioRad Laboratories, Hercules, CA) following manufacturer’s protocol.
-
bioRxiv - Cancer Biology 2020Quote: Whole cell lysate were obtained by directly lysing cells in 2x Laemmli Sample Buffer (Bio-Rad, #1610737) containing reducing reagent and boiling ...
-
bioRxiv - Microbiology 2021Quote: ... one tube of cells was harvested per day and counted using a TC20 Automatic cell counter (BioRad). Vector control transfected amoebae were used as a negative control ...
-
bioRxiv - Microbiology 2021Quote: ... one tube of cells was harvested per day and counted using a TC20 Automatic cell counter (BioRad). Vector control transfected amoebae were used as a negative control ...
-
bioRxiv - Cell Biology 2022Quote: ... Cells were then counted with the TC20™ Automated Cell Counter (Bio-Rad, Marnes-la-Coquette, France). Next ...
-
bioRxiv - Biophysics 2020Quote: ... Cell counts and viabilities were determined by using standard Trypan blue exclusion methods in cell counter (BioRad).