Labshake search
Citations for Bio-Rad :
1701 - 1750 of 10000+ citations for Two Hybrid System Construction kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2022Quote: ... and bands visualized with the Chemidoc imaging system (BioRad). The following primary antibodies were used ...
-
Reducing mitochondrial ribosomal gene expression does not alter metabolic health or lifespan in micebioRxiv - Cell Biology 2022Quote: ... and the Mini-PROTEAN system (Bio-Rad Cat# 1658006). SDS-PAGE was run at a constant 90 volts across the gel for 30 minutes and then 120 volts for 50-60 minutes in a 4°C cold room ...
-
bioRxiv - Cell Biology 2022Quote: ... using a Trans-Blot Turbo Transfer System (Bio-Rad). Membranes were blocked in TBST (20 mM Tris-HCl pH 7.4 ...
-
bioRxiv - Genetics 2022Quote: ... and the ChemiDoc™ Touch Imaging System (Bio-Rad).
-
bioRxiv - Plant Biology 2022Quote: ... and a CFX96™ Real Time System (Bio-Rad) running a standard program (initially 95°C for 30sec ...
-
bioRxiv - Plant Biology 2022Quote: ... in a Protean Tetra Cell electrophoresis system (Bio-Rad). After SDS-PAGE ...
-
bioRxiv - Neuroscience 2022Quote: ... and imaged using a ChemiDoc MP System (Bio-Rad).
-
bioRxiv - Microbiology 2022Quote: ... Images were acquired using Chemidoc Imaging system (Bio-Rad). Each band intensity on the immunoblot were quantified using ImagJ software ...
-
bioRxiv - Molecular Biology 2022Quote: ... Bands were detected using a GelDoc Imaging System (Biorad). The effects of metal ions on GlcA and GlcNAc transfer were analyzed using similar reaction conditions ...
-
bioRxiv - Physiology 2022Quote: ... and imaged using a ChemiDoc Imaging System (Bio-rad).
-
bioRxiv - Molecular Biology 2022Quote: ... using CFX96 Touch Real-Time PCR Detection System (BIORAD) according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2022Quote: ... using the Trans-Blot Turbo Transfer System from BioRad. The membrane was blocked for 1h at RT (shaking ...
-
bioRxiv - Neuroscience 2022Quote: ... using the Trans-Blot Turbo Transfer System (Bio-Rad). Subsequently ...
-
bioRxiv - Zoology 2022Quote: ... blots were visualized using chemiluminescence imaging system (Bio-Rad) with SuperSignal West (Thermo Fisher Scientific).
-
bioRxiv - Microbiology 2022Quote: ... and visualized using a ChemiDoc Imaging System (Bio-Rad).
-
bioRxiv - Molecular Biology 2022Quote: ... and visualized with a ChemiDoc XRS+ System (Bio-Rad) and quantitated using Image J (91) ...
-
bioRxiv - Microbiology 2022Quote: ... in the CFX96TM Real-Time PCR System (Bio-Rad). The sequences of all primers are listed in Table S1.
-
bioRxiv - Microbiology 2022Quote: ... on a CFX96 Real-Time System (BioRad, Hercules, CA). Libraries were diluted to 2 nM stock ...
-
bioRxiv - Microbiology 2022Quote: ... using the Trans-Blot Turbo transfer system (Bio-Rad). Membranes were blocked for one hour with 5% nonfat dried milk in TBS-T (20 mM Tris·HCl (pH 7.6) ...
-
bioRxiv - Synthetic Biology 2022Quote: ... and imaged using a ChemiDoc XRS+System (Bio-Rad).
-
bioRxiv - Synthetic Biology 2022Quote: ... and imaged using a ChemiDocTM XRS+System (Bio-Rad). An identical protocol was followed for detection of cell-surface expression of ETEC O78 O-PS.
-
bioRxiv - Pathology 2022Quote: ... and the ChemiDoc™ Imaging System (Biorad, Hercules, CA).
-
bioRxiv - Neuroscience 2022Quote: ... in the ChemiDoc™ XRS+ System from Bio-Rad. The integrated intensity of each band was calculated using computer-assisted densitometry analysis with Image J 1.52a software (National Institutes of Health ...
-
bioRxiv - Developmental Biology 2022Quote: ... using a semi-dry transfer system (BIO-RAD, 1704150EDU). The membrane was blocked with 5% non-fat milk blocking solution and incubated with primary antibodies at 4°C overnight ...
-
bioRxiv - Neuroscience 2023Quote: ... and imaged on a Chemidoc XRS system (Bio-Rad).
-
bioRxiv - Neuroscience 2023Quote: ... Images were acquired using ChemiDoc XRS+ System (Bio-Rad). The Image Lab software was used for WB quantification to quantify the band intensity for the protein of interest ...
-
bioRxiv - Neuroscience 2023Quote: ... with the Trans-Blot Turbo Transfer System (Bio-Rad). The membrane was blocked with 5% fat-free skim milk in TBST (Tris buffer saline with 0.05% Tween 20 ...
-
bioRxiv - Neuroscience 2022Quote: ... and imaged in a Chemidoc Imaging System (Bio-Rad).
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... and a CFX96TM Real-Time System device (Bio-Rad). Gene expression levels of RRM1 were determined using the ΔΔCt method ...
-
bioRxiv - Microbiology 2023Quote: ... In a CFX ConnectTM Real-Time System (Bio-Rad) the amplification and detection of PCR products was measured ...
-
bioRxiv - Microbiology 2023Quote: ... on a Gel Doc XR+ imaging system (Bio-Rad). To investigate chaperone-fiber interactions ...
-
bioRxiv - Cancer Biology 2024Quote: ... and captured by ChemiDoc MP Imaging System (Bio-Rad). For membrane re-hybridization ...
-
bioRxiv - Neuroscience 2022Quote: ... Chemiluminescence was detected using ChemiDoc Gel Imaging System (Biorad). Finally ...
-
bioRxiv - Neuroscience 2022Quote: ... and immunoreactivity was detected on ChemiDoc system (Bio-Rad). Analysis was performed using Image Lab software (Bio-Rad).
-
bioRxiv - Neuroscience 2022Quote: ... on Bio-Rad CFX96 Real-Time System (Bio-Rad). The samples were run at 95°C for 10 min followed by 40 cycles of 95°C 15 s ...
-
bioRxiv - Neuroscience 2022Quote: ... using the Trans-Blot Turbo transfer system (Bio-Rad). Membranes were blocked in Odyssey Blocking Buffer (Li-Cor ...
-
bioRxiv - Molecular Biology 2022Quote: ... a gel imaging system and electrophoresis apparatus (Bio-Rad), the Ettan IPGphor 3 for electrophoresis by isoelectric focusing (IEF ...
-
bioRxiv - Molecular Biology 2022Quote: ... and quantified using Chemidoc MP imaging system (Bio-Rad).
-
bioRxiv - Plant Biology 2022Quote: ... and documented in a ChemiDoc MP imaging system (BioRad). Experiments were performed in three biological replicates ...
-
bioRxiv - Microbiology 2022Quote: ... and a CFX96 Real-Time Detection System (Bio-Rad). Total 16S rRNA gene quantities were targeted using bacterial-specific primers ...
-
bioRxiv - Microbiology 2022Quote: ... on a CFX96 Real-Time Detection System (Bio-Rad) in reaction volumes of 15 μl under the following conditions ...
-
bioRxiv - Microbiology 2022Quote: ... and CFX96 Touch Real-Time PCR Detection System (Biorad). The primer set for qPCR is ‘GGGGTGCTATCAGAGGCATC’ and ‘TAGGACCCTTGGTACCGGAG’.
-
bioRxiv - Cell Biology 2022Quote: ... Images were recorded using a Chemidoc system (Bio-Rad) and quantified using Fiji.
-
bioRxiv - Plant Biology 2022Quote: ... and a CFX96 Real-Time PCR system (Bio-Rad).
-
bioRxiv - Neuroscience 2022Quote: ... and captured by a ChemiDoc MP imaging system (Biorad). The primary antibodies used were ...
-
bioRxiv - Physiology 2022Quote: ... Detection was performed on a ChemiDoc system (Bio-Rad Laboratories ...
-
bioRxiv - Cell Biology 2022Quote: ... ChemiDoc MP Imaging System (Bio-Rad Laboratories, CA, USA) was used for peroxidase coupled secondary antibodies ...
-
bioRxiv - Plant Biology 2022Quote: ... and documented by the ChemiDoc MP system (Bio-rad). The intensity of the bioluminescent signal was analyzed using ImageJ software (Schneider et al. ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... The CFX96 Touch Real-Time PCR Detection System (Biorad) was used and quantification was performed with the DDCt method ...
-
bioRxiv - Cancer Biology 2022Quote: ... and then visualized with the ChemiDoc Imaging System (BioRad).