Labshake search
Citations for Bio-Rad :
1701 - 1750 of 10000+ citations for Human Chemokine C X C Motif Receptor 5 CXCR5 Protein since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... Protein concentration was determined using a Lowry assay (DC Protein Assay, BioRAD) and each sample from the pulsed SILAC experiment was mixed in a 1:1 ratio with medium SILAC-labelled proteins from the spike-in control ...
-
bioRxiv - Cancer Biology 2023Quote: ... Protein concentration in supernatants were quantified using DC protein assay kit (BioRad). Equal amounts of total proteins (20μg ...
-
bioRxiv - Microbiology 2023Quote: ... we measured total viral protein with the DC Protein Assay (Bio-Rad). The following reagent was obtained through BEI Resources ...
-
bioRxiv - Plant Biology 2023Quote: ... The protein concentration was determined by an RC DC protein assay (BIORAD) (Raghupathi and Diwan ...
-
Mitigating a TDP-43 proteinopathy by targeting ataxin-2 using RNA-targeting CRISPR effector proteinsbioRxiv - Bioengineering 2023Quote: Protein concentration was determined using the DC Protein Assay Kit (Bio-Rad). Protein (30 μg for lysate from cells and 50 μg for lysate from tissues ...
-
bioRxiv - Neuroscience 2024Quote: ... with protein concentrations determined via Bradford protein assays (Bio-Rad, Hercules, CA).
-
bioRxiv - Plant Biology 2024Quote: ... Total protein concentration was determined by DC protein assay Kit (Bio-Rad) with bovine serum albumin standards ...
-
bioRxiv - Molecular Biology 2023Quote: ... Protein concentration was assessed by DC Protein Assay (Bio-Rad, Hercules, CA), as per the manufacturer’s instructions.
-
bioRxiv - Molecular Biology 2023Quote: ... Protein concentration was determined using the Pierce BCA Protein Assay kit (Biorad). Proteins were then separated in 10-12% SDS-PAGE gels (or Tris-Tricine gel 16% gels for microproteins ...
-
bioRxiv - Molecular Biology 2023Quote: ... Protein size was determined with Precision Plus Protein Standards (Bio-Rad, USA) in SDS-PAGE analysis.
-
bioRxiv - Microbiology 2023Quote: ... Protein concentrations were determined using Protein Assay Dye Reagent Concentrate (Bio-Rad). Supernatants were incubated with sample buffer at 95°C for 5 min ...
-
bioRxiv - Microbiology 2023Quote: ... Protein was separated by 4-12% Bis-Tris protein gel (Bio-Rad) and transferred to 0.2 μm PVDF membrane (Cytiva) ...
-
bioRxiv - Cancer Biology 2023Quote: ... and protein concentration was performed using DC protein assay (Bio-Rad Laboratories). An equal amount of protein was subjected to reduction and alkylation by incubating the samples with 5mM DTT for 1h at 37°C ...
-
bioRxiv - Molecular Biology 2023Quote: ... Protein concentrations were quantified with Bio-Rad protein assay (Bio-Rad, 5000006).
-
bioRxiv - Genomics 2023Quote: ... Proteins were quantified by Quick Start™ Bradford Protein Assay (Bio-Rad). The proteins for western blotting were boiled at 95°C for 10 min in Laemmli buffer and resolved by 8% acrylamide gel ...
-
bioRxiv - Pathology 2023Quote: ... The protein concentration was determined by a protein assay kit (Bio-Rad) using bovine serum albumin as the standard (Han et al. ...
-
bioRxiv - Biochemistry 2023Quote: ... All Blue (Precision Plus Protein All Blue Prestained Protein Standards (BioRad, #1610373) or Page Ruler Prestained (Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2023Quote: ... Protein concentrations were determined using the QuickStart Bradford protein assay (Bio-Rad) according to the manufacturer’s protocol.Eluates from immunoprecipitations were subsequently incubated with 5mM DTT at RT for 40 min ...
-
bioRxiv - Developmental Biology 2023Quote: ... Protein concentration was then assessed using Bio-Rad protein assay reagent (Biorad). Samples were denatured at 95°C for 10 min in loading buffer then resolved in 6% ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Protein concentration was determined by the DC protein assay (BioRad, Hercules, CA). Protein reduction was accomplished using 5 mM tris 2-(carboxyethyl)phosphine (TCEP ...
-
Mitochondrial Apolipoprotein MIC26 is a metabolic rheostat regulating central cellular fuel pathwaysbioRxiv - Cell Biology 2023Quote: ... Protein concentration was determined using DCTM protein assay Kit (BIO-RAD, 5000116). SDS samples were prepared with Laemmli buffer and heated for 5 min at 95°C ...
-
bioRxiv - Neuroscience 2024Quote: ... The protein concentration was determined by the Bradford protein assay (Bio-Rad) using a BSA curve ...
-
bioRxiv - Neuroscience 2024Quote: ... Protein concentration was determined using the RC DC Protein Assay (Bio-Rad) according to the manufacturer’s instructions ...
-
bioRxiv - Biophysics 2024Quote: ... and total protein content was quantified using DC Protein Assay (Biorad, 5000113). 15 to 30 μg of total protein lysate were resolved on SDS-PAGE gel and transferred to a nitrocellulose membrane (Cytiva ...
-
bioRxiv - Cell Biology 2024Quote: ... protein concentrations were measured with the protein assay dye reagent (Bio-Rad) and 10 μg protein was mixed with 80 μl reaction buffer (lysis buffer without Triton X-100 ...
-
bioRxiv - Cancer Biology 2024Quote: ... Protein concentrations were measured using the DC Protein Assay Kit (Bio-Rad). 25-30 µg protein samples were run in SDS–PAGE followed by protein transfer using Mini Gel Tank and Mini Blot Module (Life Technologies) ...
-
bioRxiv - Cancer Biology 2024Quote: ... Protein concentration was quantified using the DC protein assay (Bio-Rad Laboratories) and a standard curve obtained with increasing concentrations of Bovine Serum Albumin (BSA ...
-
bioRxiv - Genetics 2022Quote: ... reverse 5’ - CACGTGGGACCGCTCGTCTCC) and MUC3B-specific primers (forward 5’ CGGGGGCCAGTGGGATGGCCTCAAG-3’; reverse 5’-CACGCGGGACCGCTCGTCTCT-3’) using SsoFast EvaGreen Supermix (#1725200, Bio-Rad) on a CFX96 Real-Time PCR Detection System (Bio-Rad ...
-
bioRxiv - Cell Biology 2021Quote: ... cocktail tablets and the protein concentration were determined by Bio-Rad Protein assay (Bio-Rad). Equivalent amounts of protein were resolved by SDS-PAGE and transferred to polyvinylidene fluoride microporous membrane (Millipore) ...
-
bioRxiv - Biochemistry 2022Quote: ... standard proteins (#1511901, BioRad) were eluted to calculate a calibration curve of the column ...
-
bioRxiv - Immunology 2019Quote: ... Prestained protein ladder (BioRad) was loaded as a reference ...
-
bioRxiv - Cell Biology 2020Quote: ... The protein concentration was determined by Bio-Rad Protein assay (Bio-Rad). Protein lysates were pre-clear in Protein G magnetic beads (Bio-rad ...
-
bioRxiv - Biochemistry 2019Quote: ... Cell pellets were lysed by sonication and raw protein measured by Bio-Rad Protein Assay (Bio-Rad). Lysates were normalized ...
-
bioRxiv - Biochemistry 2020Quote: ... Protein Assay (Bio-Rad) was used to determine protein concentrations using bovine serum albumin (Thermo Scientific ...
-
bioRxiv - Immunology 2023Quote: ... Prestained Protein Standards (BioRad Precision Plus Protein™ Kaleidoscope™ Standards #1610375 ...
-
bioRxiv - Neuroscience 2023Quote: ... Protein standards (Bio-Rad) were prepared in NER buffer from the NE-PER kit ...
-
bioRxiv - Cancer Biology 2023Quote: ... cocktail tablets and the protein concentration were determined by Bio-Rad Protein assay (Bio-Rad). Equivalent amounts of protein were resolved by SDS-PAGE and transferred to polyvinylidene fluoride microporous membrane (Millipore) ...
-
bioRxiv - Microbiology 2023Quote: ... Purified proteins were visualized by SDS-PAGE electrophoretic protein separation and quantified by Bio-Rad Protein Assay (Bio-Rad). The proteins were either stored at 4 °C for immediate use ...
-
bioRxiv - Cell Biology 2020Quote: ... For immunoblotting an appropriate volume of 1 x Laemmli (Bio-rad) sample loading buffer was added to the sample (10 μg of protein) ...
-
bioRxiv - Genetics 2021Quote: ... 1 x RPP30 primer/HEX labelled probe mix (Bio-Rad Laboratories), 1μl XhoI digestion mix consisting of 5U XhoI restriction enzyme and 1 x NEB buffer 2.1 (New England Biolabs) ...
-
bioRxiv - Developmental Biology 2019Quote: ... The beads were suspended in 2 x Laemmli sample buffer (BioRad) containing 15% 2-mercaptoethanol and boiled for 10 min.
-
bioRxiv - Microbiology 2020Quote: ... Triton X-100 (20% w/v) with AG501-X8 resin (BioRad) was added dropwise ...
-
bioRxiv - Microbiology 2021Quote: ... Triton X-100 (20% w/v) with AG501-X8 resin (BioRad) was added dropwise ...
-
bioRxiv - Cell Biology 2021Quote: ... 900 μF in an electroporation apparatus (X pulser Bio-Rad Laboratories) then immediately resuspended in complete culture medium and plated ...
-
bioRxiv - Neuroscience 2021Quote: ... and permeabilized with 0.1% Triton X-100 (Bio-Rad 161-0407) in 1X phosphate buffered saline (PBS) ...
-
bioRxiv - Neuroscience 2019Quote: ... and permeabilized with 0.1% Triton X-100 (Bio-rad 161-0407) in PBS ...
-
bioRxiv - Microbiology 2020Quote: ... gondii RHTatiΔKu80 parasites using a Gene Pulser X Cell electroporator (BioRad). Selection was done with 20 μM chloramphenicol ...
-
bioRxiv - Bioengineering 2023Quote: ... an Aminex HPX-87H 300 x 7.8 mm column (BioRad, USA), a RID-10A index refraction detector and a CBM-20A controller (Shimadzu ...
-
bioRxiv - Neuroscience 2024Quote: ... X-ray films were scanned using GS-900 Calibrated Densitometer (BioRad), and optical density was measured using Image Lab Software version 5.2.1 ...
-
bioRxiv - Microbiology 2024Quote: ... followed by biomass solubilization using 0.1% Triton X-100 (Bio-Rad) in PBS ...