Labshake search
Citations for Bio-Rad :
1601 - 1650 of 10000+ citations for Human Oxidation resistance protein 1 OXR1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: ... 7.5 mg of proteins were diluted in ChIP buffer supplemented with 0.01% SDS and precleared 1 h at 4 °C with 50 μl of protein A agarose beads (BioRad) and 100 μg BSA ...
-
bioRxiv - Microbiology 2022Quote: ... the samples were washed extensively with lysis buffer and the proteins were eluted by boiling 5 ul of the resin with 5x SDS loading buffer and the proteins were detected by western blot analysis using rabbit antibody to FLAG (1:2,000, BioRad) or mouse antibody to Myc (1:2000 ...
-
bioRxiv - Biochemistry 2022Quote: ... 1 μL protein was injected onto either a self-packed buffer exchange column (P6 polyacrylamide gel, Bio-Rad Laboratories) or a prototype desalting column from Thermo Fisher Scientific and online buffer exchanged to 200 mM ammonium acetate ...
-
bioRxiv - Biochemistry 2021Quote: ... The protein was incubated at 4°C for 1 h with Bio-Beads™ SM-2 resin (Bio-Rad) equilibrated with 100 mM Tris-HCl ...
-
bioRxiv - Bioengineering 2021Quote: ... A sample containing 1-20µg of protein was loaded into a 4-15% precast gel (Bio-Rad Mini-ProTEAN) and run at 60V for 20min followed by 160V for 1 hour ...
-
bioRxiv - Pathology 2022Quote: ... The expression levels of target proteins were quantified with Quantity One 1-D Analysis Software (Bio-Rad, Hercules, CA) and normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH ...
-
bioRxiv - Genomics 2019Quote: ... All blots were visualized using a goat anti-rabbit IgG:alkaline phosphatase fusion protein at 1:3,000 dilution in conjunction with BCIP/NBT color development (Bio-Rad).
-
bioRxiv - Genetics 2023Quote: ... ∼25 μL sample was run out on a 7.5% SDS-PA at 150V for ∼1 h alongside a protein standard (BioRad Precision Plus Protein Dual Color Standard) ...
-
bioRxiv - Developmental Biology 2023Quote: ... and aliquots were 1:50 in water prior to Bradford protein assay (Bio-Rad, Hercules, CA, USA, Cat# 5000006). Samples were then normalized to 1 mg/mL protein in 0.1% Azo prior to reduction with 30 mM DTT at 37C for 1 h and alkylation with 30 mM chloroacetamide for 45 min ...
-
bioRxiv - Microbiology 2021Quote: ... the Pro™ Human Cytokine 27-plex Assay (Bio-Rad) was used according to the manufacturer’s protocol and read on a Bio-Plex 3D suspension array system including a Bio-Plex Manager software v 6.0 (Bio-Rad).
-
bioRxiv - Developmental Biology 2022Quote: ... or anti-Human IgG Kappa (STAR 127, Bio-Rad, USA) control antibody
-
bioRxiv - Microbiology 2022Quote: ... and HRP-conjugated goat anti-human IgG (BioRad #172-1050) were used as secondary antibodies for ELISA and western blot assays.
-
bioRxiv - Immunology 2019Quote: ... or RasGRP1 (PrimePCR SYBR Green Assay RasGRP1 human, Bio-Rad, amplicon context sequence GGTTCCTTGGTTCCCGGGCATAGGAAAGCTCATAGATTTCATCCTCAGTGTAGTAAAGAT CCAGGGATAACGTCAGCAAGTGTACCAAGTCCTTGTTAGCCTCCAAGG (exon 10) ...
-
bioRxiv - Molecular Biology 2022Quote: ... goat anti-human IgG F(ab’)2 (STAR126, Bio-Rad), anti-M13-pVIII-HRP (Cytiva 27-9421-01 ...
-
bioRxiv - Immunology 2023Quote: ... goat anti-human– horseradish peroxidase (HRP) secondary antibody (Bio-Rad) at a 1:3,000 dilution was applied for 1 h at 4°C ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Mouse monoclonal anti-Human Vinculin (V284) antibody (Bio-Rad, MCA465GA), 1:1,000 ...
-
bioRxiv - Molecular Biology 2021Quote: ... Cleaned samples were solubilized in the previous buffer described above and then quantified with the RCDC Protein Assay kit (Biorad, Hercules, CA). Ten μg of protein from each sample were digested in-solution using both Lys-C and Trypsin ...
-
bioRxiv - Cancer Biology 2021Quote: ... and 20 μg of proteins per sample were resolved in 10 or 12% gels (TGX™ FastCast™ Acrylamide kit, Bio-Rad) via electrophoresis ...
-
bioRxiv - Immunology 2020Quote: ... equal protein amounts of the lysates (25 μg) were applied to the Bio-Plex Mouse Cytokine 23-plex Assay Kit (Bio-Rad Laboratories) and measured with the BioPlex200 system and BioPlex-Manager 6.2 according to manufacturer’s instructions ...
-
bioRxiv - Genomics 2020Quote: ... the membrane was incubated with peroxidase-conjugated goat anti-mouse IgG and proteins were detected using a chemiluminescence detection kit (Super-Signal West Pico, Pierce) and a ChemiDoc™ MP system (Bio-Rad).
-
bioRxiv - Neuroscience 2023Quote: ... Once ready for testing we quantified the amount of mitochondria from each isolation using Bio-Rad Protein Assay Kit (Bio-Rad, #5000001), plated 3µg/50µl/well onto a 96 well plate with all animals having 6-8 technical replicates (101085-004 ...
-
bioRxiv - Biochemistry 2023Quote: ... The determination of casein concentration by the Lowry method was performed using the DC™ protein assay kit purchased from Bio-Rad Laboratories (California ...
-
bioRxiv - Genetics 2023Quote: ... and luciferase activities were normalized to total protein levels in the WCEs extracts determined using the Bradford assay kit (Bio-Rad Laboratories).
-
bioRxiv - Cancer Biology 2024Quote: ... Protein pellet was resuspended in UTC buffer (8 M urea, 2 M thiourea, 4% CHAPS) and quantified using RC DC™ Protein Assay Kit (Bio-Rad). Sample with 80 µg proteins resuspended in rehydration buffer (8 M urea ...
-
bioRxiv - Immunology 2020Quote: Staining of 2×105 cells per well was performed with mouse anti-human CD79α (clone HM57, Bio-Rad AbD Serotec, Puchheim, Germany, 1:100) for identification of B cells and Alexa Fluor 647-conjugated rat anti-human CD3∊ (clone CD3-12 ...
-
bioRxiv - Neuroscience 2024Quote: ... and the absorbance value of each well was measured at a wavelength of 450 nm on microplate ELISA reader (Microplate Manager v5.2.1 software, Bio-Rad Laboratories).
-
bioRxiv - Cell Biology 2020Quote: Protein samples were run in Mini-PROTEAN® TGX 4-15% Precast protein gels (BioRad) and transferred to nitrocellulose membranes ...
-
bioRxiv - Cell Biology 2020Quote: ... 25 μg of protein / well and Precision Plus Protein All Blue Standards (Biorad #161-0373) were run on 4-20% polyacrylamide gels (Biorad #4561096 ...
-
bioRxiv - Cell Biology 2020Quote: ... Protein concentrations were measured by Bradford assay using Protein Assay Dye Reagent Concentrate (Bio-Rad). All western blots were revealed using ECL (GE Healthcare).
-
bioRxiv - Cell Biology 2020Quote: ... Protein concentrations were measured by Bradford assay using Protein Assay Dye Reagent Concentrate (Bio-Rad). All western blots were revealed using ECL (GE Healthcare).
-
bioRxiv - Developmental Biology 2021Quote: ... The supernatants were collected and protein concentration was calculated by Bradford Protein Assay (Bio-rad). The denatured lysates were electrophoresed on SDS-PAGE gels and transferred to polyvinylidene fluoride membranes (BioExpress) ...
-
bioRxiv - Neuroscience 2021Quote: ... the protein concentration in the supernatant was determined using DC protein assays (Bio-rad, 5000116) with bovine serum albumin solutions as standards ...
-
bioRxiv - Physiology 2022Quote: ... Samples were loaded alongside 10 µL protein ladder (Precision Plus Protein Standards Kaleidoscope ladder, BioRad). Self-cast gels (Mini-PROTEAN ...
-
bioRxiv - Molecular Biology 2021Quote: ... Protein concentration in each fraction of soluble proteins was determined by Bradford assay (Bio-Rad). Specific ß-galactosidase activities in the same fractions were measured according to Miller (51 ...
-
bioRxiv - Molecular Biology 2021Quote: ... Protein concentration of the clarified lysate was measured using DC™ Protein Assay (Bio-Rad). Protein levels of wild-type or mutant Rad6 were determined by immunoblotting using anti-Flag M2 antibody (Sigma).
-
bioRxiv - Cancer Biology 2019Quote: ... Total protein concentrations were determined using the Bio-Rad Protein Assay (Bio-Rad, Hercules, CA). Nuclear extracts containing the total of 40 µg protein were separated on a 10% Tris-SDS PAGE gel (Bio-Rad Mini-PROTEAN® TGX) ...
-
bioRxiv - Biochemistry 2019Quote: ... Protein concentrations of the supernatants were determined with Bradford protein assay (Bio-rad, Hercules, CA). Supernatants were mixed with 4x β-mercaptoethanol Laemmli sample buffer to a final 25 μg protein/sample ...
-
bioRxiv - Cell Biology 2019Quote: ... Protein concentrations were measured by Bradford assay using Protein Assay Dye Reagent Concentrate (Bio-Rad).
-
bioRxiv - Neuroscience 2019Quote: ... The protein concentration was measured using the BCA protein assay according to manufacturer’s instruction (BioRad).
-
bioRxiv - Neuroscience 2020Quote: ... All fractions were assayed for protein content (Bio-Rad Protein Assay; Bio-Rad, Hercules, CA) and frozen at −80°C until further use ...
-
bioRxiv - Neuroscience 2020Quote: ... All fractions were assayed for protein content (Bio-Rad Protein Assay; Bio-Rad, Hercules, CA) and frozen at −80°C until further use ...
-
bioRxiv - Molecular Biology 2019Quote: ... Protein concentration was measured using the Bradford protein assay following the manufacturer’s instructions (Bio-Rad). The samples were mixed with 6X loading buffer (240 mM Tris-HCl ...
-
bioRxiv - Molecular Biology 2019Quote: ... Total protein concentration was determined by DC™ Protein Assay (Bio-Rad, Hercules, CA, USA). All the samples were kept at −70°C until they were used for analysis.
-
bioRxiv - Genetics 2021Quote: ... The protein content of the lysate was determined using Bio-Rad Protein Assay (Bio-Rad) on a spectrophotometer ...
-
bioRxiv - Plant Biology 2020Quote: ... The protein concentration in samples was determined using the DC Protein Assay (BioRad, CA, USA). Protein samples (10 μg per lane ...
-
bioRxiv - Biochemistry 2020Quote: ... Protein content of the samples was determined with the RC DC protein assay from BioRad. For the first dimension ...
-
bioRxiv - Neuroscience 2020Quote: ... Total protein concentration was determined by BCA protein assay (Bio-Rad Laboratories, Hercules,CA, USA), cell lysate samples were aliquoted and stored at −80°C till used ...
-
bioRxiv - Plant Biology 2021Quote: ... and total protein concentration was estimated using Quick Start Bradford Protein Assay (Bio-Rad Laboratories). Protein samples were subjected to in-solution tryptic digestion followed by mass spectrometry (MS ...
-
bioRxiv - Biochemistry 2021Quote: ... Protein was detected using a Protein Simple xxx with Clarity Western ECL Substrate (Bio-Rad). Band intensity was measured using ImageJ (NIH).
-
bioRxiv - Cell Biology 2021Quote: ... The protein amount was determined with Bio-Rad protein assay reagent (Bio-Rad, Hercules, CA) using bovine serum albumin (BSA ...