Labshake search
Citations for Bio-Rad :
1451 - 1500 of 3153 citations for Mucin 1 Human HEK293 Fc since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2019Quote: ... cells were washed once with cold PBS and lysed in 1× sample buffer (Biorad) containing DTT ...
-
bioRxiv - Microbiology 2021Quote: ... RNA (1 mg total) was reverse transcribed using iScript cDNA Synthesis Kit (Bio-Rad) and diluted to 100 μl in ddH20 for subsequent qPCR ...
-
bioRxiv - Cell Biology 2019Quote: ... Secondary antibodies used were goat anti-mouse IgG HRP conjugate (Bio-Rad; 1:2000) and goat anti-rabbit IgG HRP conjugate (Bio-Rad ...
-
bioRxiv - Molecular Biology 2020Quote: ... The 20 μL ddPCR reaction mixture contained 1× ddPCR master mix (Bio-Rad, USA), 0.9 μM primers ...
-
bioRxiv - Plant Biology 2019Quote: ... The plasmids were coated on gold microparticles (1 μm diameter, Bio-Rad, California, USA) and bombarded on about one week old sorghum seedlings according to the protocol of (Jose-Estanyol ...
-
bioRxiv - Cell Biology 2020Quote: ... 0.1% Tween-20 (TBS-T): Goat anti-mouse Starbright700 (1:10000, Bio-Rad,12004158), Goat anti-rabbit IRDye800 (1:10000 ...
-
bioRxiv - Genetics 2020Quote: ... absorbance at 254 nm was measured and recorded (Econo UV monitor EM-1, Biorad) using the Gradient Profiler software (version 2.07) ...
-
bioRxiv - Biochemistry 2021Quote: ... and monoclonal anti mouse secondary antibodies conjugated to horseradish peroxidase (1:5000, Bio-Rad). After incubation with ECL substrate (BioRad ...
-
bioRxiv - Cancer Biology 2021Quote: ... starting from 1 μ were designed through Beacon Designer 2.0 Software (Bio-Rad Laboratories). CLUH primers sequences were TACATCATGGGCGACTACGC (forward primer ...
-
bioRxiv - Genetics 2020Quote: ... membranes were incubated with HRP-conjugated goat-anti-mouse IgG (1:2000; Bio-Rad) for 1 h at room temperature ...
-
bioRxiv - Genetics 2021Quote: ... absorbance at 254 nm was measured and recorded (Econo UV monitor EM-1, Biorad), using the Gradient Profiler software (version 2.07) ...
-
bioRxiv - Neuroscience 2021Quote: ... We immunopanned RGCs from retinal suspension using Thy1.2 antibody (CD90, 1:800, Bio-RAD) and 0.02% BSA (Sigma-Aldrich ...
-
bioRxiv - Plant Biology 2021Quote: ... and 1 ml Luminol/enhancer solution (Clarity™ Western ECL, BIORAD, Les-Ulis, France) and observed using ChemiDoc (ChemiDoc™ Imaging Systems ...
-
bioRxiv - Biophysics 2020Quote: ... Secondary antibody was goat anti-mouse IgG horseradish peroxidase conjugate (1:5,000; Bio-Rad). Blots were developed using the Luminata Forte Western HRP substrate reagent (Millipore ...
-
bioRxiv - Cell Biology 2021Quote: ... was used at 1:10,000 and developed with Clarity Western ECL Substrate (Bio-Rad). mRFP1 from phagolysosomes was identified by the increased gel migration compared to native mRFP1 (Katayama et al. ...
-
bioRxiv - Immunology 2020Quote: ... and cDNA synthesis was performed using 1 μg of total RNA (iScript, Bio-Rad). qPCR was performed with the following gene-specific primers ...
-
bioRxiv - Microbiology 2021Quote: ... Lysates were boiled for 5 min in 1 x Laemmli Sample Buffer (Bio-Rad) containing 5% β-mercaptoethanol ...
-
bioRxiv - Molecular Biology 2021Quote: ... Protein samples were mixed 1:4 with 4X Laemmli buffer (Bio-Rad, Lunteren, Netherlands) containing 10% (v/v ...
-
bioRxiv - Microbiology 2020Quote: ... The 20 μL qPCR mix contained 1× IQ™ SYBR Green Supermix (BIO-RAD), 0.25 μM of each primer and 1 μL of 1:10 diluted DNA from individual gradient fractions ...
-
bioRxiv - Neuroscience 2020Quote: ... 1 μg of RNA was reverse transcribed with iScript™ reverse transcription (Biorad, 1708841). Quantitative polymerase chain reaction was performed using Sso Advanced Universal SYBR Green Supermix (Bio-Rad 1725274 ...
-
bioRxiv - Developmental Biology 2022Quote: ... Revelation was performed using corresponding antibody (Table 1) with ECL Clarity Max (Biorad, 1705062). Images were acquired with ChemiDoc camera (Biorad ...
-
bioRxiv - Cancer Biology 2022Quote: ... 1 μg of total RNA was reverse-transcribed using iScript RT Supermix (Bio-Rad). A real-time PCR was run in triplicate using iTaq Universal SYBR Green Supermix (Bio-Rad ...
-
bioRxiv - Biophysics 2022Quote: ... Samples (1 mg of protein per well) were loaded onto a protein gel (BioRad, 4-15% Criterion TGX Stain-Free Precast Gel) ...
-
bioRxiv - Immunology 2022Quote: ... Secondary antibodies: goat anti-rabbit HRP (BioRad 1706515 or Invitrogen 65-6120, 1:5,000), anti-mouse HRP (Santa Cruz sc-525409 ...
-
bioRxiv - Microbiology 2022Quote: ... either HRP-conjugated goat anti-rabbit or an anti-mouse antibody (1:5,000, BioRad). Antibodies were detected using the enhanced chemiluminescence system (Immobilon Forte Western HRP substrate ...
-
bioRxiv - Microbiology 2022Quote: ... mouse monoclonal Ab (mAb)-anti-sialoadhesin (Bio-rad, Inc., Hercules, CA, USA; 1:250), goat pAb anti-integrin-α3 (Santa Cruz biotechnology ...
-
bioRxiv - Plant Biology 2022Quote: ... A 10 µl reaction was composed of 1× SYBR Green Supermix (Bio-Rad, US), 0.4 µM forward and reverse primers and 1 µl of cDNA ...
-
bioRxiv - Systems Biology 2023Quote: ... The secondary antibody used was 1:5000 HRP goat anti-rabbit (Bio-Rad #1706515).
-
bioRxiv - Genetics 2022Quote: ... suspended myoblasts were mixed with melted 1% UltraPure Low Melting Point Agarose (Bio-Rad) at 37°C to form plugs ...
-
bioRxiv - Molecular Biology 2022Quote: ... for 1 hour at 37 °C before resolved on 10% TBE PAGE gels (BioRad) run at 100 volts for 2 hours ...
-
bioRxiv - Microbiology 2022Quote: ... cell pellet was gently resuspended in 200 μL of 1 X Laemmli Buffer (Biorad) supplemented with β-mercaptoethanol at a final concentration of 2.5 % ...
-
bioRxiv - Microbiology 2022Quote: ... at 10 V for 1 hr using Trans-Blot Turbo Transfer System (Bio-Rad). Then ...
-
bioRxiv - Systems Biology 2022Quote: ... StarBright Blue 700 goat anti-mouse IgG (catalog number 12004159; Bio-Rad; 1:10,000), rabbit anti-goat immunoglobulins/HRP (catalog number P0449 ...
-
bioRxiv - Plant Biology 2024Quote: ... was used for gel migration in 1 X Tris/Glycine/SDS Buffer (Bio-Rad). Protein transfer to nitrocellulose membranes (Bio-Rad ...
-
bioRxiv - Plant Biology 2024Quote: ... The goat anti-mouse IgG-HRP conjugate (cat#1706516, 1:4,000 dilution; BIO-RAD) and the secondary antibody were used to detect anti-GFP and anti-ACTIN.
-
bioRxiv - Cell Biology 2024Quote: ... RNA (1 μg) was reverse transcribed using iScript™ cDNA Synthesis Kit (Bio-Rad), and PCR was performed using Q5® High-Fidelity 2X Master Mix (NEB) ...
-
bioRxiv - Molecular Biology 2024Quote: ... HRP signal was detected in 9:1 mix of Clarity:Clarity Max ECl reagent (BioRad) and captured using a Chemidoc Touch imager (BioRad).
-
bioRxiv - Genetics 2024Quote: ... This solution was rapidly combined with 40 % acrylamide (37.5:1 mono:bis) solution (Bio-Rad) (sufficient for a final concentration of 2 %) ...
-
bioRxiv - Cancer Biology 2023Quote: ... membranes were incubated with 1:5000 HPRT-conjugated anti-mouse secondary antibody (Biorad, 1706516) for 1 h at room temperature ...
-
bioRxiv - Developmental Biology 2023Quote: ... and secondary antibodies HRP-conjugated goat anti-mouse IgG (1:5000; 1706516, Bio-Rad) or goat anti-rabbit IgG (1:5000 ...
-
bioRxiv - Genetics 2024Quote: ... The primary antibodies (NF-kB, #8242 Cell Signaling, 1:1000; CD3, MCA-1477 Biorad, 1:100 ...
-
bioRxiv - Genetics 2024Quote: ... goat anti-mouse IgG (H+L) HRP conjugate (1:10000, Bio-Rad Cat. # 1706516).
-
bioRxiv - Genomics 2024Quote: ... and counted (1:4 dilution) with TC20 Automated Cell Counter (Bio-rad cat. #1450102). Cells were fixed using Parse Biosciences’ Nuclei Fixation Kit v1 (Parse Biosciences cat ...
-
bioRxiv - Genetics 2023Quote: ... membranes were incubated in secondary goat anti rabbit antibody (1:10000, Bio-Rad, 1706515) for one hour ...
-
bioRxiv - Cancer Biology 2024Quote: ... at 1:10,000 and goat anti-rabbit HRP-conjugated (1721019, Bio-Rad, RRID: AB_11125143) at 1:10,000 ...
-
bioRxiv - Biophysics 2023Quote: ... The purity of 12mer arrays was confirmed using APAGE (2% acrylamide, 1% Biorad agarose) gels stained with SyBr Gold (Life Technologies) ...
-
bioRxiv - Cell Biology 2024Quote: ... followed by horseradish peroxidase-conjugated Goat- anti-mouse second antibodies (1:10000; BioRad # 1721011) for 1hr at the room temperature.
-
bioRxiv - Cancer Biology 2023Quote: ... and 1 μg was reverse transcribed using the iScript cDNA Synthesis kit (Bio-Rad). Real-time quantitative RT– PCR was performed on a LightCycler 2.0 apparatus (Roche ...
-
bioRxiv - Molecular Biology 2023Quote: ... A total of 1 μg RNA was reverse-transcribed with Iscript Supermix (Bio-rad). cDNA was then used to amplify the target genes by SYBR Green PCR Master Mix (Thermo Fisher Scientific) ...
-
bioRxiv - Plant Biology 2023Quote: ... Samples were mounted on a glass slide with 1% low-melt agarose (Bio-Rad) and submerged in de-ionized water.