Labshake search
Citations for Bio-Rad :
101 - 150 of 295 citations for Recombinant Human PTGS2 His tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2021Quote: ... by immunoprecipitation of endogenous or endogenously Flag-tagged Piwi (eF-Piwi): The anti-Piwi antibody and Surebeads Protein A Magnetic bead (Bio-Rad, 1614013) were used to immunoprecipitated endogenous Piwi-piRNAs from witld type OSC ...
-
bioRxiv - Biochemistry 2022Quote: ... The refolded mature FAM237A was eluted from the C4 reverse-phase column (Hi-Pore reversed-phase column, 4.6 × 250 mm, Bio-Rad) by the acidic acetonitrile gradient.
-
bioRxiv - Microbiology 2023Quote: ... The was filtered through a 0.45 μm filter and His-MSI-2 was purified with HisTrapTM FF column (Cytiva) using the Econo Gradient Pump (BIORAD) according to the manufacturer’s protocol and overnight dialysis ...
-
bioRxiv - Microbiology 2023Quote: ... Ni-NTA agarose with the bound His-SUMO-SigN was loaded on a Poly-Prep® Chromatography Column (Bio-Rad), washed with P2 buffer and subsequently with the P2 buffer with the 30 mM imidazole ...
-
bioRxiv - Biochemistry 2022Quote: ... The αM and β2 subunits of recombinant Mac-1 integrin were resolved on 4-20% polyacrylamide (BioRad), gradient gels by SDS-PAGE and stained with Coomassie brilliant blue R250 ...
-
bioRxiv - Microbiology 2023Quote: ... The gel carrying the recombinant proteins and their derivatives was eventually stained with Coomassie Blue (Bio-Rad) for 1 hour and was de-stained with a de-staining solution (20% methanol and 10% acetic acid in water).
-
bioRxiv - Developmental Biology 2020Quote: Levels of PAI1 in human plasma were measured using a Bio-Plex multiplex enzyme immunoassay (Customized Human Cancer Biomarker Assay, Bio-Rad Laboratories). Plasma was diluted 1:4 in assay diluent prior to performing the assay ...
-
bioRxiv - Microbiology 2020Quote: ... Cell culture supernatants were screened for the presence of 27 human cytokines and chemokines using the Bio-Plex Pro Human Cytokine Standard 27-Plex kit (Bio-Rad Laboratory) on a FLEXMAP 3D® analyzer (Luminex ...
-
bioRxiv - Biochemistry 2023Quote: ... The culture medium after incubation was analyzed for the presence of secreted human cytokines using Bio-Plex Pro Human Cytokine 17-plex Assay (Bio-Rad, USA) and Bio-Plex 200 Systems (Bio-Rad ...
-
bioRxiv - Immunology 2021Quote: ... Conjugates against anti-human IgG-HRP (BioRad, Richmond, CA) or anti-human IgA-HRP (Nordic BioSite ...
-
bioRxiv - Cancer Biology 2020Quote: ... with certified human GAPDH and LOX primers (Bio-Rad). The reaction was run in CFX Connect 96 Real Time PCR system (Bio-Rad) ...
-
bioRxiv - Cancer Biology 2021Quote: ... Bio-Plex Pro Total Human GAPDH (BioRad, USA, 171V60019M), Bio-Plex Pro Total β-Actin (BioRad ...
-
bioRxiv - Molecular Biology 2022Quote: ... 1× AP3B1-HEX-labelled human reference assay (dHsaCP1000001, BioRAD), 1/40 HindIII (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2022Quote: ... 1× AP3B1-HEX labelled human reference assay (Bio-Rad), 1/40 HaeIII (Invitrogen ...
-
bioRxiv - Microbiology 2023Quote: ... Goat F(ab)2 anti-human IgG: HRP (Biorad), Goat anti-mouse IgG (H/L) ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... human cytokine 17 and 27-plex from Bio-Rad, (NSW ...
-
bioRxiv - Microbiology 2021Quote: ... were treated with 20% blocking buffer (Li-Cor Biosciences, Lincoln, US) followed by incubation with anti-His-tag mouse primary antibody (dilution1/5000, Bio-Rad) and revelation with a IRDye 800CW Goat anti-mouse IgG secondary antibody (dilution 1/10000 ...
-
bioRxiv - Microbiology 2021Quote: ... and then incubated with a secondary goat anti-rabbit (for the anti-YjbI antiserum) or goat anti–mouse (for the anti–His-tag antibody) antibody conjugated with horseradish peroxidase (Bio-Rad) for 2 h ...
-
bioRxiv - Biochemistry 2023Quote: ... The 6× His-tag blots were washed with TMST and TSM and developed with the Clarity Western ECL kit (Bio-Rad) and imaged in a Gel-Doc system (Bio-Rad) ...
-
bioRxiv - Microbiology 2021Quote: ... Recombinant protein purities were assessed by SDS-PAGE using 4-20% Mini-Protean TGX gels (Bio-Rad, #4561094) and quantified using the BCA Protein Estimation kit (ThermoFisher Scientific ...
-
bioRxiv - Bioengineering 2021Quote: Ramos B cells were retrovirally transduced with a construct encoding spike protein tagged with the fluorophore mScarlet at the C-terminus and sorted by FACS (Bio-Rad S3e Cell Sorter). For the experiment ...
-
bioRxiv - Biochemistry 2020Quote: ... Membranes were probed for 1 hour at room temperature with 1:500 anti-XLF(New England Peptides, details in Methods under Immunodepletion) or 1:1000 anti-His (Bio-Rad MCA1396A) in PBST with 2.5% BSA ...
-
bioRxiv - Molecular Biology 2020Quote: ... goat anti-human IgG Fc (Biorad; 5211-8004; 1:2000) and rabbit anti-Vinculin (EPR8185 ...
-
bioRxiv - Microbiology 2021Quote: ... the Pro™ Human Cytokine 27-plex Assay (Bio-Rad) was used according to the manufacturer’s protocol and read on a Bio-Plex 3D suspension array system including a Bio-Plex Manager software v 6.0 (Bio-Rad).
-
bioRxiv - Developmental Biology 2022Quote: ... or anti-Human IgG Kappa (STAR 127, Bio-Rad, USA) control antibody
-
bioRxiv - Microbiology 2022Quote: ... and HRP-conjugated goat anti-human IgG (BioRad #172-1050) were used as secondary antibodies for ELISA and western blot assays.
-
bioRxiv - Immunology 2019Quote: ... or RasGRP1 (PrimePCR SYBR Green Assay RasGRP1 human, Bio-Rad, amplicon context sequence GGTTCCTTGGTTCCCGGGCATAGGAAAGCTCATAGATTTCATCCTCAGTGTAGTAAAGAT CCAGGGATAACGTCAGCAAGTGTACCAAGTCCTTGTTAGCCTCCAAGG (exon 10) ...
-
bioRxiv - Cancer Biology 2021Quote: ... Bio-Plex Pro Human Cytokine ICAM-1 (BioRad, USA; 171B6009M) and Bio-Plex Pro Human Cytokine VCAM-1 (BioRad ...
-
bioRxiv - Molecular Biology 2022Quote: ... goat anti-human IgG F(ab’)2 (STAR126, Bio-Rad), anti-M13-pVIII-HRP (Cytiva 27-9421-01 ...
-
bioRxiv - Immunology 2023Quote: ... goat anti-human– horseradish peroxidase (HRP) secondary antibody (Bio-Rad) at a 1:3,000 dilution was applied for 1 h at 4°C ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Mouse monoclonal anti-Human Vinculin (V284) antibody (Bio-Rad, MCA465GA), 1:1,000 ...
-
bioRxiv - Cell Biology 2020Quote: ... The blot was then incubated with HRP-conjugated anti-His monoclonal antibody (1:5000) and detected with supersignalfemto substrate (Thermoscientific, USA) using ChemiDoc imaging system (Bio-Rad laboratories, USA).
-
bioRxiv - Biochemistry 2022Quote: ... acidified to pH3–4 by adding appropriate amount of TFA and subjected to HPLC purification using a C4 reverse-phase column (Hi-Pore reversed-phase column, 4.6 × 250 mm, Bio-Rad, Hercules, CA, USA). The S-sulfonated FAM237A was eluted from the C4 reverse-phase column by an acidic acetonitrile gradient composed of the acidic solvent A (0.1% aqueous TFA ...
-
bioRxiv - Biochemistry 2023Quote: ... and the S-sulfonated FAM237B was eluted from a C4 reverse-phase column (Hi-Pore reversed-phase column, 4.6 × 250 mm, Bio-Rad, Hercules, CA, USA) by an acidic acetonitrile gradient ...
-
bioRxiv - Microbiology 2024Quote: ... and HopAM1 and C-terminal Flag-tagged IpaH4 were generated by PCR amplification using primers containing Flag sequences and flanking SacII / PacI off pIB/V5-His templates using iProof DNA polymerase (Bio-Rad; Table S4) and cloned into the pDGOpIE2 vector ...
-
bioRxiv - Bioengineering 2019Quote: ... Lysate samples were analysed for recombinant protein expression by SDS PAGE (12% Mini-PROTEAN-TGX stain-free gel; Bio-Rad), using Precision Plus unstained protein ladder (Bio-Rad ...
-
bioRxiv - Plant Biology 2020Quote: ... Recombinant proteins were analysed by Western Blot using custom-made SLR1 specific polyclonal antibody with Mini-Protean II system (Biorad).
-
bioRxiv - Immunology 2021Quote: ... Recombinant Bovine Interleukin-8 PBP039 and Goat anti Bovine Interleukin-8 Ab conjugated to biotin AHP2817B (all from Bio-Rad, protocol according to the manufacturer’s intructions).
-
bioRxiv - Biophysics 2022Quote: ... 2 μl of recombinant proteins and 1 μl of a molecular weight marker (Precision Plus Protein Kaleidoscope Prestained Protein Standards, BioRad) were applied to the PAGE lane (10 wells ...
-
bioRxiv - Biophysics 2023Quote: The monovalent streptavidin sample was kindly provided by the Howarth Lab (University of Oxford),23 and recombinant IgE Kappa (clone AbD18705_IgE, Cat#HCA190) was purchased from Bio-Rad Laboratories.
-
bioRxiv - Immunology 2024Quote: 96-well flat-bottom NUNC Maxisorp plates were coated overnight at 4 °C with 0.5 mg/mL recombinant HBsAg (BIO-RAD). Plates were washed with PBS/T ...
-
bioRxiv - Cell Biology 2024Quote: ... the soluble fraction containing recombinant MBP-RON11-His6 protein was affinity purified twice on immobilized-metal affinity chromatography (IMAC) column using FPLC (Biorad) and further purified on CHT Ceramic Hydroxyapatite column ...
-
bioRxiv - Microbiology 2022Quote: ... from 22 people were quantified using a Bio-Plex Pro™ Human Inflammation 24-Plex Panel or a Bio-Plex Pro™ Human Th17 Cytokine Panel 15-Plex Panel (Bio-Rad, Hercules, CA, USA). Cytokines were omitted from further analyses if their concentration was close to the lower limit of detection in most samples ...
-
bioRxiv - Biochemistry 2021Quote: ... Human primers were designed by using Beacon Designer software (Bio-Rad). Quantitative PCR was performed on a CFX96 real-time PCR thermocycler (Bio-Rad ...
-
bioRxiv - Immunology 2019Quote: The following antibodies were used: anti-human CD53 (MEM-53, Biorad), anti-human CD53-488 (MEM-53 ...
-
bioRxiv - Cancer Biology 2021Quote: ... and Bio-Plex Pro Human Cytokine VCAM-1 (BioRad, USA; 171B6022M) were used ...
-
bioRxiv - Immunology 2020Quote: Human CTL were transfected using a GenePulser Xcell electroporation system (BioRad). 1x106 CTL (5days after restimulation therefore in expansion phase ...
-
bioRxiv - Pathology 2023Quote: ... or mouse monoclonal antibodies against human C3d (Bio-Rad Laboratories, CA) and C4d (Santa Cruz ...
-
bioRxiv - Neuroscience 2024Quote: ... Primers/probes to detect human RPP30 (BioRad Custom Assay, Hercules, CA) were used as an endogenous reference in human samples ...
-
bioRxiv - Biochemistry 2022Quote: ... The soluble recombinant protein within the supernatant was purified and dialysed using the Profinia Affinity Chromatography Protein Purification System (Bio-Rad), with the mini profinity IMAC and mini Bio-Gel P-6 desalting cartridges (Bio-Rad) ...