Labshake search
Citations for Bio-Rad :
101 - 150 of 1276 citations for Puumala Virus Glycoprotein 2 Gc Human Heterodimeric Fc tag since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... TAG content was normalized to total protein determined using a standard Bradford Protein assay (Bio-Rad Laboratories, Hercules, CA, USA).
-
bioRxiv - Immunology 2024Quote: ... rabbit anti-FLAG-HRP (clone D6W5B, CellSignalingTechnology #86861S, RRID:AB_2800094) or anti-Strep (clone Strep-tag II StrepMAB-Classic, Biorad #MCA2489P, RRID:AB_609796) detection Abs were added for 30 minutes ...
-
bioRxiv - Biochemistry 2024Quote: ... We utilized colorimetric detection to visualize the apoAI-EfpA band(s) on the membrane after WB transfer: The primary mouse antihistidine tag antibody (BioRad) and secondary goat antimouse IgG antibody conjugated to Alkaline Phosphatase (BioRad ...
-
bioRxiv - Immunology 2019Quote: ... The calculation of IgG antibody concentration against each individual influenza virus strain rHA was performed by Bio-Plex Manager™ 6.2 software (Bio-Rad Co., CA).
-
bioRxiv - Systems Biology 2021Quote: Differential expression of ten selected transcripts in response to virus at 3-L1 stage was examined using Droplet Digital PCR (ddPCR) (Bio-Rad, Hercules, CA). Because of the difficulty in obtaining a large amount of gut RNA samples and the limited sensitivity of conventional qPCR technique to detect gene expression at a low level ...
-
bioRxiv - Pathology 2023Quote: Rabies virus N gene was amplified by real-time quantitative PCR using iTaq™ Universal SYBR® Green One-Step Kit (BIO-RAD). The primers are as follow ...
-
Striated muscle-specific base editing enables correction of mutations causing dilated cardiomyopathybioRxiv - Genetics 2022Quote: ... RNA copy numbers were determined by ddPCR (see AAV virus quantification) using Taqman primers for the WPRE element (Sup. Table 1) and Rpp30 (Biorad, assay ID: dMmuCPE5097025) as housekeeping gene.
-
bioRxiv - Biochemistry 2020Quote: ... Biobeads SM-2 (Biorad; 2 g; prewashed in nanodisc buffer) were added ...
-
bioRxiv - Developmental Biology 2020Quote: Levels of PAI1 in human plasma were measured using a Bio-Plex multiplex enzyme immunoassay (Customized Human Cancer Biomarker Assay, Bio-Rad Laboratories). Plasma was diluted 1:4 in assay diluent prior to performing the assay ...
-
bioRxiv - Microbiology 2020Quote: ... Cell culture supernatants were screened for the presence of 27 human cytokines and chemokines using the Bio-Plex Pro Human Cytokine Standard 27-Plex kit (Bio-Rad Laboratory) on a FLEXMAP 3D® analyzer (Luminex ...
-
bioRxiv - Biochemistry 2023Quote: ... The culture medium after incubation was analyzed for the presence of secreted human cytokines using Bio-Plex Pro Human Cytokine 17-plex Assay (Bio-Rad, USA) and Bio-Plex 200 Systems (Bio-Rad ...
-
bioRxiv - Immunology 2021Quote: ... Conjugates against anti-human IgG-HRP (BioRad, Richmond, CA) or anti-human IgA-HRP (Nordic BioSite ...
-
bioRxiv - Cancer Biology 2020Quote: ... with certified human GAPDH and LOX primers (Bio-Rad). The reaction was run in CFX Connect 96 Real Time PCR system (Bio-Rad) ...
-
bioRxiv - Cancer Biology 2021Quote: ... Bio-Plex Pro Total Human GAPDH (BioRad, USA, 171V60019M), Bio-Plex Pro Total β-Actin (BioRad ...
-
bioRxiv - Molecular Biology 2022Quote: ... 1× AP3B1-HEX-labelled human reference assay (dHsaCP1000001, BioRAD), 1/40 HindIII (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2022Quote: ... 1× AP3B1-HEX labelled human reference assay (Bio-Rad), 1/40 HaeIII (Invitrogen ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... human cytokine 17 and 27-plex from Bio-Rad, (NSW ...
-
bioRxiv - Genomics 2020Quote: ... 2% CleanCut (BioRad) agarose was melted at 70°C then cooled to 50°C ...
-
bioRxiv - Microbiology 2021Quote: ... with the C-terminal fluorescent tag and an empty vector containing only fluorescent tag was bombarded separately on onion peels containing MS plates using the PDS1000/He system at 1100 psi (BioRad, USA). After 36 hrs ...
-
bioRxiv - Microbiology 2021Quote: ... were treated with 20% blocking buffer (Li-Cor Biosciences, Lincoln, US) followed by incubation with anti-His-tag mouse primary antibody (dilution1/5000, Bio-Rad) and revelation with a IRDye 800CW Goat anti-mouse IgG secondary antibody (dilution 1/10000 ...
-
bioRxiv - Microbiology 2021Quote: ... and then incubated with a secondary goat anti-rabbit (for the anti-YjbI antiserum) or goat anti–mouse (for the anti–His-tag antibody) antibody conjugated with horseradish peroxidase (Bio-Rad) for 2 h ...
-
bioRxiv - Immunology 2022Quote: ... prior to overnight incubation in the same buffer with 1:2000 anti-FLAG-HRP (clone D6W5B, CellSignallingTechnology #86861S) or anti-Strep (clone Strep-tag II StrepMAB-Classic, Biorad #MCA2489P) or goat anti-mouse Igκ-HRP (SouthernBiotech #1050-05) ...
-
bioRxiv - Biochemistry 2023Quote: ... The 6× His-tag blots were washed with TMST and TSM and developed with the Clarity Western ECL kit (Bio-Rad) and imaged in a Gel-Doc system (Bio-Rad) ...
-
bioRxiv - Plant Biology 2023Quote: ... Protein was purified by chitin-based affinity chromatography upon elution with 50 mm DTT to cleave the intein tag and further by gel permeation chromatography on a Superdex S200 column using the NGC liquid chromatography system (Bio-Rad). ZmCKX5 (23 mg mL-1 ...
-
bioRxiv - Molecular Biology 2022Quote: ... (2) post-AP beads were washed twice in 500μl 2% SDS wash buffer (2% v/v SDS (BioRad, #1610418), 150mM NaCl ...
-
bioRxiv - Immunology 2019Quote: ... After quantifying the optimal virus-to-erythrocyte concentration (4HA units), serial two-fold dilutions of Fc, control IVIG (GammaGard, Baxter Healthcare) and polyclonal goat anti-influenza B (Biorad) were prepared ...
-
bioRxiv - Microbiology 2021Quote: ... the Pro™ Human Cytokine 27-plex Assay (Bio-Rad) was used according to the manufacturer’s protocol and read on a Bio-Plex 3D suspension array system including a Bio-Plex Manager software v 6.0 (Bio-Rad).
-
bioRxiv - Developmental Biology 2022Quote: ... or anti-Human IgG Kappa (STAR 127, Bio-Rad, USA) control antibody
-
bioRxiv - Microbiology 2022Quote: ... and HRP-conjugated goat anti-human IgG (BioRad #172-1050) were used as secondary antibodies for ELISA and western blot assays.
-
bioRxiv - Immunology 2019Quote: ... or RasGRP1 (PrimePCR SYBR Green Assay RasGRP1 human, Bio-Rad, amplicon context sequence GGTTCCTTGGTTCCCGGGCATAGGAAAGCTCATAGATTTCATCCTCAGTGTAGTAAAGAT CCAGGGATAACGTCAGCAAGTGTACCAAGTCCTTGTTAGCCTCCAAGG (exon 10) ...
-
bioRxiv - Cancer Biology 2021Quote: ... Bio-Plex Pro Human Cytokine ICAM-1 (BioRad, USA; 171B6009M) and Bio-Plex Pro Human Cytokine VCAM-1 (BioRad ...
-
bioRxiv - Immunology 2023Quote: ... goat anti-human– horseradish peroxidase (HRP) secondary antibody (Bio-Rad) at a 1:3,000 dilution was applied for 1 h at 4°C ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Mouse monoclonal anti-Human Vinculin (V284) antibody (Bio-Rad, MCA465GA), 1:1,000 ...
-
bioRxiv - Plant Biology 2021Quote: ... plants were irradiated with UV-B lamps using fixtures mounted 30 cm above the plants (2 W m−2 UV-B and 0.6 W m−2 UV-A, Bio-Rad ChemiDoc™XRS UV-B lamps ...
-
bioRxiv - Microbiology 2020Quote: ... Immunopurified proteins were also stained with Pro-Q® Diamond phosphoprotein gel dye (Thermo) or Phospho-Tag (ABP Biosciences, MD, USA) and visualized in a ChemiDoc MP imaging system (Bio-Rad systems) under specific emission/excitation wavelengths (550/580 nm).
-
bioRxiv - Molecular Biology 2020Quote: ... 4°C and the supernatant incubated during 4 h at 4°C with 50 µl of V5 magnetic beads (20 mg/mL of Dynabeads® M-280 Tosylactivated, Invitrogen, coupled with Anti V5-Tag Antibody, clone SV5-Pk1, Bio-Rad). The unbound fraction was discarded and the beads washed 2 times with 1ml of IP Buffer and additionally twice more with 1 ml ice cold PBS + protease inhibitors ...
-
bioRxiv - Synthetic Biology 2023Quote: ... The blocking buffer was removed and 10 ml 5% BSA-PBST with 1 μl RABBIT anti-DYKDDDDK Tag antibody (Bio-Rad, # AHP1074), 1 μl anti-MBP Monoclonal Antibody (New England Biolabs ...
-
bioRxiv - Cell Biology 2020Quote: ... 2% SDS (Bio-Rad), 10% glycerol (Sigma) ...
-
bioRxiv - Genomics 2021Quote: ... 0.128mM 2-Mercaptoethanol (BioRad), and 1X Leukemia Inhibitory Factor (purified and gifted by Barbara Panning Lab at UCSF).
-
bioRxiv - Biophysics 2021Quote: ... 2% bis-AA (BioRad) as described elsewhere 72,73 ...
-
bioRxiv - Cancer Biology 2020Quote: ... 2% bis-AA (BioRad) as described elsewhere (Fischer et al. ...
-
bioRxiv - Genomics 2022Quote: ... 2% SDS (Bio-Rad) and 2 mg/mL proteinase K (New England Biolabs) ...
-
bioRxiv - Developmental Biology 2019Quote: ... Bis (2%, Bio-Rad), the sonicated nanorod-water solution (sonicated in in bath sonicator for one hour ...
-
CXCR4-binding PET tracers link monocyte recruitment and endothelial injury in murine atherosclerosisbioRxiv - Pathology 2020Quote: ... MOMA-2 (Bio-Rad), CD45.2 (104 ...
-
bioRxiv - Biochemistry 2020Quote: ... Biobeads SM-2 (BioRad) were presoaked in methanol ...
-
bioRxiv - Cancer Biology 2022Quote: ... and 2- Mercaptoethanol (BioRad) and ran through a 4-20% Mini-ProTEAN TGX gel (BioRad) ...
-
bioRxiv - Neuroscience 2022Quote: ... with 2-mercaptaethanol (BioRad) and boiled at 95 °C for 5 minutes ...
-
bioRxiv - Cancer Biology 2023Quote: ... using Tetrad 2 (BioRad) following the manufactures protocols ...
-
bioRxiv - Cell Biology 2023Quote: ... and 2-Mercaptoethanol (BioRad) at 95°C for 5 minutes.
-
bioRxiv - Neuroscience 2024Quote: ... Imaging was performed using either an Odyssey Fc imaging system (Li-Cor) (quantified using Image StudioTM software) or a Molecular ChemiDocTM Touch Imaging System (Bio-Rad) (quantified using Image Lab 6.0.1 software).