Labshake search
Citations for Bio-Rad :
101 - 150 of 1253 citations for MMP 2 Human HEK293 His since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2020Quote: ... goat anti-human IgG Fc (Biorad; 5211-8004; 1:2000) and rabbit anti-Vinculin (EPR8185 ...
-
bioRxiv - Microbiology 2021Quote: ... the Pro™ Human Cytokine 27-plex Assay (Bio-Rad) was used according to the manufacturer’s protocol and read on a Bio-Plex 3D suspension array system including a Bio-Plex Manager software v 6.0 (Bio-Rad).
-
bioRxiv - Developmental Biology 2022Quote: ... or anti-Human IgG Kappa (STAR 127, Bio-Rad, USA) control antibody
-
bioRxiv - Microbiology 2022Quote: ... and HRP-conjugated goat anti-human IgG (BioRad #172-1050) were used as secondary antibodies for ELISA and western blot assays.
-
bioRxiv - Immunology 2019Quote: ... or RasGRP1 (PrimePCR SYBR Green Assay RasGRP1 human, Bio-Rad, amplicon context sequence GGTTCCTTGGTTCCCGGGCATAGGAAAGCTCATAGATTTCATCCTCAGTGTAGTAAAGAT CCAGGGATAACGTCAGCAAGTGTACCAAGTCCTTGTTAGCCTCCAAGG (exon 10) ...
-
bioRxiv - Cancer Biology 2021Quote: ... Bio-Plex Pro Human Cytokine ICAM-1 (BioRad, USA; 171B6009M) and Bio-Plex Pro Human Cytokine VCAM-1 (BioRad ...
-
bioRxiv - Immunology 2023Quote: ... goat anti-human– horseradish peroxidase (HRP) secondary antibody (Bio-Rad) at a 1:3,000 dilution was applied for 1 h at 4°C ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Mouse monoclonal anti-Human Vinculin (V284) antibody (Bio-Rad, MCA465GA), 1:1,000 ...
-
bioRxiv - Plant Biology 2021Quote: ... plants were irradiated with UV-B lamps using fixtures mounted 30 cm above the plants (2 W m−2 UV-B and 0.6 W m−2 UV-A, Bio-Rad ChemiDoc™XRS UV-B lamps ...
-
bioRxiv - Cell Biology 2020Quote: ... 2% SDS (Bio-Rad), 10% glycerol (Sigma) ...
-
bioRxiv - Genomics 2021Quote: ... 0.128mM 2-Mercaptoethanol (BioRad), and 1X Leukemia Inhibitory Factor (purified and gifted by Barbara Panning Lab at UCSF).
-
bioRxiv - Biophysics 2021Quote: ... 2% bis-AA (BioRad) as described elsewhere 72,73 ...
-
bioRxiv - Cancer Biology 2020Quote: ... 2% bis-AA (BioRad) as described elsewhere (Fischer et al. ...
-
bioRxiv - Genomics 2022Quote: ... 2% SDS (Bio-Rad) and 2 mg/mL proteinase K (New England Biolabs) ...
-
bioRxiv - Developmental Biology 2019Quote: ... Bis (2%, Bio-Rad), the sonicated nanorod-water solution (sonicated in in bath sonicator for one hour ...
-
CXCR4-binding PET tracers link monocyte recruitment and endothelial injury in murine atherosclerosisbioRxiv - Pathology 2020Quote: ... MOMA-2 (Bio-Rad), CD45.2 (104 ...
-
bioRxiv - Biochemistry 2020Quote: ... Biobeads SM-2 (BioRad) were presoaked in methanol ...
-
bioRxiv - Cancer Biology 2022Quote: ... and 2- Mercaptoethanol (BioRad) and ran through a 4-20% Mini-ProTEAN TGX gel (BioRad) ...
-
bioRxiv - Neuroscience 2022Quote: ... with 2-mercaptaethanol (BioRad) and boiled at 95 °C for 5 minutes ...
-
bioRxiv - Cancer Biology 2023Quote: ... using Tetrad 2 (BioRad) following the manufactures protocols ...
-
bioRxiv - Cell Biology 2023Quote: ... and 2-Mercaptoethanol (BioRad) at 95°C for 5 minutes.
-
bioRxiv - Cell Biology 2020Quote: ... The blot was then incubated with HRP-conjugated anti-His monoclonal antibody (1:5000) and detected with supersignalfemto substrate (Thermoscientific, USA) using ChemiDoc imaging system (Bio-Rad laboratories, USA).
-
bioRxiv - Biochemistry 2022Quote: ... acidified to pH3–4 by adding appropriate amount of TFA and subjected to HPLC purification using a C4 reverse-phase column (Hi-Pore reversed-phase column, 4.6 × 250 mm, Bio-Rad, Hercules, CA, USA). The S-sulfonated FAM237A was eluted from the C4 reverse-phase column by an acidic acetonitrile gradient composed of the acidic solvent A (0.1% aqueous TFA ...
-
bioRxiv - Biochemistry 2023Quote: ... and the S-sulfonated FAM237B was eluted from a C4 reverse-phase column (Hi-Pore reversed-phase column, 4.6 × 250 mm, Bio-Rad, Hercules, CA, USA) by an acidic acetonitrile gradient ...
-
bioRxiv - Microbiology 2024Quote: ... and HopAM1 and C-terminal Flag-tagged IpaH4 were generated by PCR amplification using primers containing Flag sequences and flanking SacII / PacI off pIB/V5-His templates using iProof DNA polymerase (Bio-Rad; Table S4) and cloned into the pDGOpIE2 vector ...
-
bioRxiv - Microbiology 2022Quote: ... from 22 people were quantified using a Bio-Plex Pro™ Human Inflammation 24-Plex Panel or a Bio-Plex Pro™ Human Th17 Cytokine Panel 15-Plex Panel (Bio-Rad, Hercules, CA, USA). Cytokines were omitted from further analyses if their concentration was close to the lower limit of detection in most samples ...
-
bioRxiv - Biochemistry 2021Quote: ... Human primers were designed by using Beacon Designer software (Bio-Rad). Quantitative PCR was performed on a CFX96 real-time PCR thermocycler (Bio-Rad ...
-
bioRxiv - Immunology 2019Quote: The following antibodies were used: anti-human CD53 (MEM-53, Biorad), anti-human CD53-488 (MEM-53 ...
-
bioRxiv - Cancer Biology 2021Quote: ... and Bio-Plex Pro Human Cytokine VCAM-1 (BioRad, USA; 171B6022M) were used ...
-
bioRxiv - Immunology 2020Quote: Human CTL were transfected using a GenePulser Xcell electroporation system (BioRad). 1x106 CTL (5days after restimulation therefore in expansion phase ...
-
bioRxiv - Pathology 2023Quote: ... or mouse monoclonal antibodies against human C3d (Bio-Rad Laboratories, CA) and C4d (Santa Cruz ...
-
bioRxiv - Neuroscience 2024Quote: ... Primers/probes to detect human RPP30 (BioRad Custom Assay, Hercules, CA) were used as an endogenous reference in human samples ...
-
bioRxiv - Immunology 2021Quote: ... then blocked with 2% blocking buffer (PBS + 2% non-fat dry milk (Bio-Rad) + 2% goat serum + 0.05% Tween-20 ...
-
bioRxiv - Immunology 2022Quote: ... then blocked with 2% blocking buffer (PBS + 2% non-fat dry milk (Bio-Rad) + 2% goat serum + 0.05% Tween-20 ...
-
bioRxiv - Immunology 2019Quote: ... and 2-Mercapoethanol (BIO-RAD) was added to every protein sample with 5 minutes boiling prior to running on gels for western blots ...
-
bioRxiv - Biophysics 2019Quote: ... Bio-Beads SM-2 (Biorad) were added to a 50 mg ml-1 concentration and incubated at 4° C overnight to remove detergent.
-
bioRxiv - Cell Biology 2019Quote: ... and 2-Mercaptoethanol (BioRad #1610710) and boiled at 95°C for 5 minutes ...
-
bioRxiv - Genomics 2020Quote: ... + 2 μl SilentFect (Bio-Rad) was incubated at RT for 5 min before mixing with 2 μl siRNA (20 μM stock ...
-
bioRxiv - Cell Biology 2020Quote: ... 2× loading buffer (Biorad, 1610768) was added to hairpin samples ...
-
bioRxiv - Microbiology 2020Quote: ... and 2-mercaptoethanol (Bio-Rad), heated at 100°C for 5 minutes ...
-
CXCR4-binding PET tracers link monocyte recruitment and endothelial injury in murine atherosclerosisbioRxiv - Pathology 2020Quote: ... and MOMA-2 (Bio-Rad). Plaque size was analyzed by ORO staining to provide contrast ...
-
bioRxiv - Physiology 2019Quote: ... and 2-mercaptoethanol (Bio-rad) and heated at 95°C for 5-10 min ...
-
bioRxiv - Microbiology 2022Quote: ... + 2-mercaptoethanol (Bio-Rad #1610710) directly to the cell monolayer followed by incubation at 95°C for 15 minutes ...
-
bioRxiv - Microbiology 2022Quote: ... 2 mm cuvette (Bio-Rad). The mixture was recovered for 2-3 h in 1 mL of NB medium at 28℃ and then cultured for 2 h after adding aTc to a final concentration of 200 μg/mL ...
-
bioRxiv - Biophysics 2023Quote: ... 2% bis-acrylamide (Bio-Rad), and fluorescent beads (yellow or Texas red with ~0.5 μm diameter ...
-
bioRxiv - Molecular Biology 2023Quote: ... + 2 µl SilentFect (Bio-Rad) was incubated at room temperature (RT ...
-
bioRxiv - Genomics 2023Quote: ... 0.128mM 2-Mercaptoethanol (BioRad 1610710XTU), and 1X Leukemia Inhibitory Factor (purified and gifted by Barbara Panning Lab at UCSF) ...
-
bioRxiv - Immunology 2022Quote: ... Pre-designed human gene primers were purchased from Bio-Rad (supplemental Table). Human PPIA was amplified in parallel and used as the reference gene in quantification ...
-
bioRxiv - Biophysics 2020Quote: ... and mouse anti-human CD34 (QBEND 10 clone, Ms IgG1, Bio-Rad). Briefly ...
-
bioRxiv - Cancer Biology 2022Quote: ... Human primers for HLA-DRB1 and VCAM1 were purchased from Bio-Rad.