Labshake search
Citations for Bio-Rad :
101 - 150 of 1189 citations for Lysozyme C LYZ Human HEK293 His since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2019Quote: ... primer and probe hybridization temperature that was checked individually by PCR using a gradient ranging from 57.5 to 61.4°C in intervals of 0.8°C (CFX96 Touch™ Bio-Rad), ii ...
-
bioRxiv - Biochemistry 2021Quote: ... MDH2 aliquots were heated to 42 °C for 10 min then returned to 37 °C in a thermocycler (BioRad), while native samples were maintained at 37 °C ...
-
bioRxiv - Microbiology 2023Quote: ... The fluorescence was measured at 512 nm along a temperature gradient from 20 to 100 °C (0.5°C increase every 10 s) in the CFX ConnectTM real-time thermocycler (BioRad) with the Cfx MaestroTM software ...
-
bioRxiv - Biochemistry 2020Quote: ... Membranes were probed for 1 hour at room temperature with 1:500 anti-XLF(New England Peptides, details in Methods under Immunodepletion) or 1:1000 anti-His (Bio-Rad MCA1396A) in PBST with 2.5% BSA ...
-
bioRxiv - Pathology 2019Quote: ... Affi-gel 10 affinity resins were covalently cross-linked to his-tagged GT198 protein as antigen for affinity purification of anti-GT198 according to the manufacturer’s protocol (Bio-Rad, Hercules, CA). FFPE tumor sections or tumor microarrays were deparaffinized and dehydrated through xylene and ethanol series ...
-
bioRxiv - Molecular Biology 2020Quote: ... goat anti-human IgG Fc (Biorad; 5211-8004; 1:2000) and rabbit anti-Vinculin (EPR8185 ...
-
bioRxiv - Microbiology 2021Quote: ... the Pro™ Human Cytokine 27-plex Assay (Bio-Rad) was used according to the manufacturer’s protocol and read on a Bio-Plex 3D suspension array system including a Bio-Plex Manager software v 6.0 (Bio-Rad).
-
bioRxiv - Developmental Biology 2022Quote: ... or anti-Human IgG Kappa (STAR 127, Bio-Rad, USA) control antibody
-
bioRxiv - Microbiology 2022Quote: ... and HRP-conjugated goat anti-human IgG (BioRad #172-1050) were used as secondary antibodies for ELISA and western blot assays.
-
bioRxiv - Immunology 2019Quote: ... or RasGRP1 (PrimePCR SYBR Green Assay RasGRP1 human, Bio-Rad, amplicon context sequence GGTTCCTTGGTTCCCGGGCATAGGAAAGCTCATAGATTTCATCCTCAGTGTAGTAAAGAT CCAGGGATAACGTCAGCAAGTGTACCAAGTCCTTGTTAGCCTCCAAGG (exon 10) ...
-
bioRxiv - Cancer Biology 2021Quote: ... Bio-Plex Pro Human Cytokine ICAM-1 (BioRad, USA; 171B6009M) and Bio-Plex Pro Human Cytokine VCAM-1 (BioRad ...
-
bioRxiv - Molecular Biology 2022Quote: ... goat anti-human IgG F(ab’)2 (STAR126, Bio-Rad), anti-M13-pVIII-HRP (Cytiva 27-9421-01 ...
-
bioRxiv - Immunology 2023Quote: ... goat anti-human– horseradish peroxidase (HRP) secondary antibody (Bio-Rad) at a 1:3,000 dilution was applied for 1 h at 4°C ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Mouse monoclonal anti-Human Vinculin (V284) antibody (Bio-Rad, MCA465GA), 1:1,000 ...
-
bioRxiv - Physiology 2019Quote: ... initiation at 95°C/10 s followed by 45 amplification cycles (60°C/15 s) on the CFX Thermal cycler (Biorad).
-
bioRxiv - Systems Biology 2021Quote: ... followed by 15 s at 95 °C and 60 s at 58 °C for 40 cycles using Biorad CFX384 thermocycler (Biorad). The mRNA levels of genes encoding cytokine expression were normalized relative to the mean levels of the housekeeping gene and compared using the 2−ΔΔCt method as described previously2 ...
-
bioRxiv - Systems Biology 2020Quote: ... reverse transcription for 20 mins at 46 °C and inactivation for 1 min at 95 °C) in a thermal cycler (C1000 Touch, Biorad). TaqMan Fast Advanced Master Mix (Applied Biosystems ...
-
bioRxiv - Systems Biology 2020Quote: ... 40 cycles of PCR denaturing for 5 secs at 95 °C and annealing/extending for 30 secs at 55 °C) in real-time PCR system (CFX384 Touch, Biorad).
-
bioRxiv - Microbiology 2020Quote: ... 73105b and 73106f pseudotyped viruses were incubated at temperatures from 37°C to 50°C for 60 minutes using temperature gradient on PCR thermal cycler (BioRad). Pseudoviruses were then aliquoted in a 96-well culture plate ...
-
bioRxiv - Biophysics 2022Quote: ... The protein sample was incubated at 40°C and 80 °C respectively for 1 h in a PCR cycler (BioRad) with a heated lid to prevent evaporation ...
-
bioRxiv - Microbiology 2019Quote: ... Quantitative real-time PCR was carried out in triplicates and was performed at a 2-step reaction with 95°C denaturation and 56°C annealing and extension for 35 cycles on a CFX96 Real-Time System (BIORAD). Relative quantification of target genes was determined using Bio-Rad CFX manager 3.1 software ...
-
bioRxiv - Neuroscience 2022Quote: ... then denatured for 5 min at 95°C and annealed by gradual cooling down at −0.1 °C/sec using a PCR thermocycler (BioRad T100). Annealed oligos were subsequently inserted into BbsI-digested vector pX330-U6-Chimeric_BB-CBh-hSpCas9 (Addgene #42230) ...
-
bioRxiv - Biophysics 2022Quote: ... The mixture was then heated up to 95°C for 5 minutes and cooled down to 30°C at the rate of 1°C per minute using a thermal cycler (BioRad).
-
bioRxiv - Molecular Biology 2022Quote: ... at a ratio of 1:2 in 100 µL of TE by heating to 95°C for 3 min followed by cooling to 25°C at 0.1 °C/min in a T100 thermal cycler (Bio-Rad). In Figures ...
-
bioRxiv - Molecular Biology 2022Quote: ... and heating to 95°C for 3 min followed by cooling to 25°C at 0.1 °C/min in a T100 thermal cycler (Bio-Rad). Primer extension assays were performed either as time courses (up to 240 min ...
-
bioRxiv - Zoology 2022Quote: ... and folded by heating to 95°C for 2 min and slowly cooling down at 0.1 °C per second using a thermocycler (Bio-Rad). DsRNA concentrations were adjusted to 3 or 14 μg / μl using SpeedVac Concentrator (Thermo Scientific ...
-
bioRxiv - Molecular Biology 2023Quote: ... The prepared assay plate was exposed to temperature increases from 25 ⁰C to 95 ⁰C with 1 ⁰C increments for 5 s each using a CFX Connect Real-Time PCR Detection System (BioRad). SYBR fluorescence was detected after every temperature increase ...
-
bioRxiv - Neuroscience 2023Quote: ... followed by 40 cycles of 95 °C for 5 sec and 60 °C for 30 sec using the CFX 96 real-time systems (Biorad). The 2−ΔΔCt method was used to analyze the data (Schmittgen and Livak ...
-
bioRxiv - Systems Biology 2023Quote: ... 40 cycles of PCR denaturing for 5 secs at 95 °C and annealing/extending for 30 secs at 55 °C) in real-time PCR system (CFX384 Touch, Biorad). The results were normalized to GAPDH from the same well ...
-
bioRxiv - Cancer Biology 2022Quote: ... 95°C for 2 min followed by 40 cycles of 95°C for 15 sec and 60°C for 1 min (BioRad). The following primers from Integrated DNA Technologies (IDT ...
-
bioRxiv - Biochemistry 2023Quote: ... Samples were heated from 10 °C to 95 °C (10 s at each 0.5 °C step) using a CFX Connect qPCR with CFX Manager software (Bio-Rad). Melting temperatures were calculated with DSFWorld27 (by model 2).
-
bioRxiv - Microbiology 2023Quote: ... and 40 cycles of PCR (5 s at 95°C followed by 20 s at 60°C) in a CFX Opus 96 Real-Time PCR System (BioRad). Results were analyzed by the Comparative Ct Method (ΔΔCt Method ...
-
bioRxiv - Cancer Biology 2023Quote: ... followed by 15 minutes at 50°C and 5 minutes at 85°C in T100 Thermal Cycler (1861096, Bio-Rad). Real-time qPCR reactions were performed using SsoAdvanced Universal SYBR® Green Supermix (1725274 ...
-
bioRxiv - Systems Biology 2023Quote: ... reverse transcription for 20 mins at 46 °C and inactivation for 1 min at 95 °C) in a thermal cycler (C1000 Touch, Biorad). For gene expression assays ...
-
bioRxiv - Plant Biology 2024Quote: ... using 45 cycles of 15 sec at 95°C and 30 sec at 60°C in a CFX96 cycler (Biorad). Data were normalized to the transcript encoding PP2A subunit A3 (At1g13320 ...
-
bioRxiv - Neuroscience 2024Quote: ... 72°C (30s) and 1 cycle of 72°C for 5 min (C1000 Touch Thermal Cycler, Bio-Rad, Hercules, CA). 2–5 μl of the PCR reactions were subjected to gel electrophoresis using a 3% agarose gel in tris-borate-ethylenediamine tetraacetic acid buffer ...
-
bioRxiv - Plant Biology 2024Quote: ... using 45 cycles of 15 s at 95°C and 30 s at 60°C in a CFX96 cycler (Biorad). Primers are listed in Additional file 1.
-
bioRxiv - Immunology 2024Quote: ... 72°C for 5 minutes (BioRad, Hercules, CA). Genomic PCR was performed using the following primers ...
-
bioRxiv - Cell Biology 2020Quote: ... The blot was then incubated with HRP-conjugated anti-His monoclonal antibody (1:5000) and detected with supersignalfemto substrate (Thermoscientific, USA) using ChemiDoc imaging system (Bio-Rad laboratories, USA).
-
bioRxiv - Biochemistry 2022Quote: ... acidified to pH3–4 by adding appropriate amount of TFA and subjected to HPLC purification using a C4 reverse-phase column (Hi-Pore reversed-phase column, 4.6 × 250 mm, Bio-Rad, Hercules, CA, USA). The S-sulfonated FAM237A was eluted from the C4 reverse-phase column by an acidic acetonitrile gradient composed of the acidic solvent A (0.1% aqueous TFA ...
-
bioRxiv - Biochemistry 2023Quote: ... and the S-sulfonated FAM237B was eluted from a C4 reverse-phase column (Hi-Pore reversed-phase column, 4.6 × 250 mm, Bio-Rad, Hercules, CA, USA) by an acidic acetonitrile gradient ...
-
bioRxiv - Microbiology 2024Quote: ... and HopAM1 and C-terminal Flag-tagged IpaH4 were generated by PCR amplification using primers containing Flag sequences and flanking SacII / PacI off pIB/V5-His templates using iProof DNA polymerase (Bio-Rad; Table S4) and cloned into the pDGOpIE2 vector ...
-
bioRxiv - Cell Biology 2020Quote: ... to pH 8.88 first for 5 min at 95 °C followed by 60 °C for 3 h on a T100 Thermal Cycler (Bio-Rad) with the heated lid set to 105 °C ...
-
bioRxiv - Developmental Biology 2020Quote: ... 30 second at 72°C and a final extension of 7 minutes at 72 °C in a thermal cycler (T100TM Thermal Cycler, Bio-Rad). Five μl of PCR product was visualized on a non-denaturing 1% agarose gel with a 100bp ladder ...
-
bioRxiv - Developmental Biology 2020Quote: ... 50 seconds at 72°C and a final extension of 5 minutes at 72 °C in a thermal cycler (T100TM Thermal Cycler, Bio-Rad). In order to standardize the expression pattern of NvDsx ...
-
bioRxiv - Molecular Biology 2020Quote: ... The deamination reaction was then carried out by incubating in a thermal cycler for four cycles of 5 minutes at 70°C followed by 1 hour at 60°C and then desalted with Micro Bio-spin 6 chromatography columns (Bio-Rad). RNA was desulphonated by adding an equal volume of 1 M Tris (pH 9.0 ...
-
bioRxiv - Biophysics 2019Quote: ... Temperature was increased at a rate of 1°C per minute from 4°C to 100°C and fluorescence was measured every minute with a qPCR thermocycler in FRET mode (Bio-Rad). Aggregation temperature was determined by locating the global minimum of the second derivative of the raw data ...
-
bioRxiv - Biochemistry 2020Quote: ... Samples were heated at a rate of 0.5 °C per minute from 25 °C to 95 °C and fluorescence signals were recorded with the CFX Connect Real-Time PCR Detection System (Bio-Rad). The melting temperatures were analyzed using the derivative plots of the melting curve.
-
bioRxiv - Microbiology 2020Quote: ... was added to each well and samples were heated from 25 to 95 °C in 1 °C steps of 1 min each in a CFX96 Touch™ Real-Time PCR Detection System (BioRad). Excitation/emission filters of 492 and 516 nm were used to monitor the fluorescence increase resulting from binding of the Sypro Orange to exposed hydrophobic regions of the unfolding MsSepFcore ...
-
bioRxiv - Plant Biology 2021Quote: ... All qPCR reactions were run for 94°C for 2 min followed by 94°C for 15 s and 60°C for 1 min in a BioRad CFX384 Real Time System (Biorad, USA) qPCR machine ...