Labshake search
Citations for Bio-Rad :
101 - 150 of 2860 citations for Lysophosphatidic Acid Receptor 5 LPAR5 Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... An Aminex HPX-87H Organic Acid Analysis Column (300 × 7.8 mm, Bio-Rad, USA) was equilibrated with 5 mM sulphuric acid (H2SO4 ...
-
bioRxiv - Genomics 2023Quote: ... The total protein concentration was determined using the Bicinchoninic Acid (BCA) assay (Bio-Rad). Then ...
-
bioRxiv - Biophysics 2019Quote: ... containing 5% 2-mercaptoethanol (Bio-Rad), electrophoresed by SDS-PAGE and blotted onto nitrocellulose membrane ...
-
bioRxiv - Cell Biology 2021Quote: ... TGF-β1 (5 ng/mL, BioRad), or a combination of DEX (10-6M ...
-
bioRxiv - Genomics 2022Quote: ... 5% Blotting-Grade Blocker (BioRad, 1706404)) for 1 h at RT ...
-
bioRxiv - Microbiology 2023Quote: ... A 5% TBE-Urea gel (BioRad) was pre-run at 200 V for 15 minutes in 1X TBE buffer ...
-
bioRxiv - Cell Biology 2023Quote: ... blocked in 5% skim milk (Biorad) and incubated with primary goat anti-GST (Santa Cruz ...
-
bioRxiv - Cancer Biology 2023Quote: ... 5 μL of SYBR green (BioRad) and 0.25 μL of forward and reverse primers each were mixed with 1 μL of cDNA ...
-
bioRxiv - Microbiology 2024Quote: ... with 5% B-mercaptoethanol (Bio-Rad) was then added to the cell lysates and subsequently heated at 95°C for 5min ...
-
bioRxiv - Molecular Biology 2024Quote: ... C) 5’-CTTCAAGGAGGACTGCCAC & and 5’-TGGGGTAGGTGCCGAAGT) and target concentration was determined using QuantaSoft Software™ (Bio-Rad).
-
bioRxiv - Biophysics 2021Quote: ... The soluble fraction was loaded onto a nickel-nitrilotriacetic acid column (Bio-Rad, Hercules, CA) and proteins were purified following the manufacturer’s protocols ...
-
bioRxiv - Systems Biology 2020Quote: ... organic acids and glycerol were measured using an HPX-87H column (Bio-Rad, CA, USA) at 45°C ...
-
bioRxiv - Cancer Biology 2021Quote: ... Acid-treated fiber spreads were incubated with 1/1000 rat anti-BrdU mAb (Bio-Rad) for 1.5 hour to detect CldU ...
-
bioRxiv - Immunology 2020Quote: ... Protein concentrations were measured after sonication by the bicinchoninic acid assay (Bio-Rad, Hercules, CA), and equal amounts of fragmented chromatin–protein complexes were incubated for 2 h with enclosed Dynabeads coupled to rabbit anti-Polβ (Ab26343 ...
-
bioRxiv - Physiology 2019Quote: ... Protein concentration of the supernatant was measured with bicinchoninic acid assay (BCA) kit (Bio-Rad) followed by normalization of proteins via the addition of 1x passive lysis buffer ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... the membrane blots were blocked in 5% blocking buffer (5% non-fat dry milk, Bio-Rad, in TBST) for 1 h at room temperature ...
-
bioRxiv - Cell Biology 2021Quote: ... coli antibodies (1:100, Bio-Rad Antibodies, 4329-4906), followed by DyLight 650-conjugated donkey anti-rabbit IgG antibodies (1:1000 ...
-
bioRxiv - Microbiology 2020Quote: ... and 5% non-fat milk (Bio-Rad) for 1 hour at room temp ...
-
bioRxiv - Molecular Biology 2019Quote: ... which was blocked with 5% milk (BioRad, Hercules ...
-
bioRxiv - Physiology 2019Quote: ... and an iQTM 5 System (Bio-Rad) were used ...
-
bioRxiv - Cell Biology 2019Quote: ... Membranes were blocked in 5% milk (BioRad) and incubated with antibodies for BMAL-1 (Abcam ...
-
bioRxiv - Neuroscience 2020Quote: ... Blocking solution contained 5% milk powder (BioRad) in Tris-buffered saline containing 0.2% Tween 20 ...
-
bioRxiv - Microbiology 2021Quote: ... resolved by 5% TBE gel (Bio-Rad), and visualized using an Odyssey infrared imager (LI-COR Biosciences).
-
bioRxiv - Cancer Biology 2020Quote: ... supplemented with 5% β-Mercaptoethanol (BioRad 1610710) and heated for 10 min at 100°C ...
-
bioRxiv - Microbiology 2020Quote: ... and 5% non-fat milk (Bio-Rad)) for 1 hour at room temp ...
-
bioRxiv - Cancer Biology 2020Quote: ... Membranes were blocked in 5% Milk (BioRad) in 1XTBS-T and incubated overnight in primary antibodies diluted in 5% milk at 4°C ...
-
bioRxiv - Immunology 2022Quote: ... blocked with 5% blocking protein (Bio-Rad) for 1 h ...
-
bioRxiv - Cell Biology 2022Quote: ... in a 5 second interval (Bio-Rad Gene Pulser Xcell Electroporation Systems) ...
-
bioRxiv - Microbiology 2022Quote: ... containing 5% β-mercaptoethanol (Bio-Rad Laboratories) and boiling sample for 7 minutes followed by western blot analysis.
-
bioRxiv - Immunology 2020Quote: ... 5-μg/mL of sheep IgG (Biorad) and purified TNP (BD Pharmingen) ...
-
bioRxiv - Physiology 2023Quote: ... 5 μl SYBR Green mastermix (iTaq, Biorad) and 4 μl cDNA ...
-
bioRxiv - Cell Biology 2022Quote: ... blocked in 5% blocking buffer (Bio-Rad), blotted in primary and secondary antibodies ...
-
bioRxiv - Microbiology 2023Quote: ... containing 5% β-mercaptoethanol (Bio-Rad, 1610710), boiled for 5 minutes at 95°C and loaded onto Mini-Protean TGX Stain Free Gels 4-20% (Bio-Rad ...
-
bioRxiv - Microbiology 2023Quote: ... + 5 % βmercapto-ethanol (BioRad ref #161-0710), and heated for 5 min at 70°C ...
-
bioRxiv - Developmental Biology 2023Quote: ... blocked in 5% nonfat dry milk (BioRad), and probed with either anti-phospho-p38 MAPK (Thr180/Tyr182 ...
-
bioRxiv - Cancer Biology 2023Quote: ... 5% blotting grade blocker (Bio-Rad, 1706404XTU). The primary antibodies used are listed in Table S1 ...
-
bioRxiv - Molecular Biology 2023Quote: ... Quantum™ FITC-5 MESF beads (BioRad) were used according to the manufacturer’s protocol to estimate the length of telomeres quantitatively ...
-
bioRxiv - Microbiology 2023Quote: ... After blocking with 5% BSA (BIO-RAD) in 1 X PBS at room temperature for 1 h ...
-
bioRxiv - Immunology 2024Quote: ... blocked with 5% blocking protein (Bio-Rad) at 37°C for 1 h ...
-
bioRxiv - Cancer Biology 2020Quote: ... lysate concentrations were adjusted to equal protein concentrations using the bicinchoninic acid (BCA) protein assay (Biorad). Equal amounts of protein were mixed to a final concentration of 1x reducing sample buffer (Invitrogen ...
-
bioRxiv - Biochemistry 2020Quote: ... boric acid) Urea solutions were made fresh daily and incubated with AG 501-X8 resin (Biorad) for minimum 5 hours to remove ionic contaminants ...
-
bioRxiv - Microbiology 2022Quote: ... An Aminex HPX-87H Organic Acid Analysis Column (300 × 7.8 mm; Bio-Rad, Hercules, CA, USA) was equilibrated with 5 mM H2SO4 (Titrisol ...
-
bioRxiv - Biochemistry 2019Quote: The acetic acid was quantified using an Aminex HPX-87H (300 x 7.8 mm, Bio-Rad) column with a Carbo-H precolumn (Bio-Rad ...
-
bioRxiv - Cancer Biology 2023Quote: Nucleic acids (RNA or DNA) samples were loaded in Bio-Dot SF Microfiltration Apparatus (Bio-Rad) and allowed to bind onto the membrane ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... gene expression was normalized with the housekeeping gene Act5c (primers: 5’ –gcgcccttactctttcacca-3’ and 5’ - atgtcacggacgatttcacg-3’. We performed the RT-qPCR analysis with SYBR Green (BioRad) or qPCRBIO SyGreen Blue Mix LO-ROX (PCR BIOSYSTEMS ...
-
bioRxiv - Synthetic Biology 2023Quote: ... were cultured regularly in DMEM supplemented with 10% FBS (and 5% penicillin and streptomycinat 37°C with 5% CO2 34,35. Transfection was performed by electroporation using the Bio-Rad Gene Pulser Xcell system ...
-
bioRxiv - Immunology 2023Quote: ... 5’ GACGTGGGCTCCTTACACTGA 3’)(41) and 18s (Fwd: 5’ CTTAGAGGGACAAGTGGCG 3’, Rev: 5’ ACGCTGAGCCAGTCAGTGTA 3’)(42) using the SsoFast assay system (BioRad) was used to quantify transcripts in a BioRad CFX94 machine.
-
bioRxiv - Genetics 2022Quote: ... We washed the membrane 3× 5 minutes in TBS-T and 1× 5 minutes TBS before imaging (Bio-Rad ChemiDoc).
-
bioRxiv - Cell Biology 2023Quote: ... Membranes were washed 5 times with 0.1% Tween-20 5 minutes each then imaged using ChemiDoc Imaging system (BIO-RAD).
-
bioRxiv - Molecular Biology 2023Quote: ... 1 μl of mixed primers containing 5 μM of each primer (forward and reverse) and 5 µl of iTaq Universal SYBR Green Supermix (BioRad) in a final volume of 10 μl ...