Labshake search
Citations for Bio-Rad :
101 - 150 of 3481 citations for IL 4 Human HEK293 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: 4–20% polyacrylamide gels (Bio-Rad) were used for protein separation ...
-
bioRxiv - Immunology 2023Quote: ... 4-12% Tris-HCl (Bio-Rad) with XT MOPS running buffer (Bio-Rad) ...
-
bioRxiv - Cell Biology 2023Quote: ... 4-15% gel (Bio-Rad, #4568086). Transfer and Western Blotting was performed as described above ...
-
bioRxiv - Molecular Biology 2024Quote: ... at 4°C (Bioruptor Pico, BioRad). Then ...
-
bioRxiv - Neuroscience 2020Quote: ... Proteins were separated on 4%-15% or 4%-20% Criterion TGX precast protein gels (64134751; Bio-Rad), and transferred to an Immun-Blot PVDF membrane (1620177 ...
-
bioRxiv - Molecular Biology 2020Quote: ... goat anti-human IgG Fc (Biorad; 5211-8004; 1:2000) and rabbit anti-Vinculin (EPR8185 ...
-
bioRxiv - Microbiology 2021Quote: ... the Pro™ Human Cytokine 27-plex Assay (Bio-Rad) was used according to the manufacturer’s protocol and read on a Bio-Plex 3D suspension array system including a Bio-Plex Manager software v 6.0 (Bio-Rad).
-
bioRxiv - Developmental Biology 2022Quote: ... or anti-Human IgG Kappa (STAR 127, Bio-Rad, USA) control antibody
-
bioRxiv - Microbiology 2022Quote: ... and HRP-conjugated goat anti-human IgG (BioRad #172-1050) were used as secondary antibodies for ELISA and western blot assays.
-
bioRxiv - Immunology 2019Quote: ... or RasGRP1 (PrimePCR SYBR Green Assay RasGRP1 human, Bio-Rad, amplicon context sequence GGTTCCTTGGTTCCCGGGCATAGGAAAGCTCATAGATTTCATCCTCAGTGTAGTAAAGAT CCAGGGATAACGTCAGCAAGTGTACCAAGTCCTTGTTAGCCTCCAAGG (exon 10) ...
-
bioRxiv - Cancer Biology 2021Quote: ... Bio-Plex Pro Human Cytokine ICAM-1 (BioRad, USA; 171B6009M) and Bio-Plex Pro Human Cytokine VCAM-1 (BioRad ...
-
bioRxiv - Molecular Biology 2022Quote: ... goat anti-human IgG F(ab’)2 (STAR126, Bio-Rad), anti-M13-pVIII-HRP (Cytiva 27-9421-01 ...
-
bioRxiv - Immunology 2023Quote: ... goat anti-human– horseradish peroxidase (HRP) secondary antibody (Bio-Rad) at a 1:3,000 dilution was applied for 1 h at 4°C ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Mouse monoclonal anti-Human Vinculin (V284) antibody (Bio-Rad, MCA465GA), 1:1,000 ...
-
bioRxiv - Cancer Biology 2022Quote: ... Protein separation was performed on Mini-Protean TGX (4-15% or 4-20%) SDS-PAGE gel (Bio-Rad) and transferred to PVDF membranes (Bio-Rad) ...
-
bioRxiv - Cancer Biology 2021Quote: ... 4 were incubated overnight at 4°C and revealed using peroxidase-conjugated antibodies and an ECL kit (BioRad). Images were captured using ChemiDocTM XRS Imaging system (Biorad).
-
bioRxiv - Immunology 2022Quote: ... incubated for five days at 4°C in 40 mL of hydrogel monomer solution [4% acrylamide (Bio-Rad), 0.05% bis-acrylamide (Bio-Rad) ...
-
bioRxiv - Cell Biology 2023Quote: ... and resolved by SDS-PAGE using Criterion XT Bis-Tris precast gels (4-12%; BioRad, 3450123/4/5) and XT-MES1X as running buffer (stock 10X ...
-
bioRxiv - Cancer Biology 2023Quote: ... All western blots were run using PROTEAN TGX precast 4-15% or 4-20% gradient gels (Bio-Rad) and transferred to either 0.2μm or 0.44μm nitrocellulose membranes ...
-
bioRxiv - Cell Biology 2023Quote: ... Samples were run on 4-15% or 4-20% Mini-PROTEAN SDS-PAGE gels (Bio-Rad, Hercules, CA) in 1X TGS solution (250 mM tris ...
-
bioRxiv - Molecular Biology 2020Quote: ... or 4-15% Mini Protean gels (BioRad). Proteins were transferred to nitrocellulose membrane using Turbo-blotter (Bio-Rad) ...
-
bioRxiv - Developmental Biology 2020Quote: ... with 4% goat (Bio-Rad Laboratories, #C07SA) or donkey serum (Bio-Rad Laboratories ...
-
bioRxiv - Bioengineering 2020Quote: ... Polyacrylamide gels (Bio-Rad, 4-16 wt%). IFNγ ELISA (DY485 ...
-
bioRxiv - Neuroscience 2020Quote: ... or 4-15% (BIO-RAD #456-1083) Mini PROTEAN® gel in Tris/Glycine/SDS (BIO-RAD #1610772) ...
-
bioRxiv - Neuroscience 2022Quote: Criterion TGX 4-15% (Bio-Rad 5671084) and Mini-Protean TGX precast gels (Bio-Rad 4561083 ...
-
bioRxiv - Molecular Biology 2021Quote: 4-20% precast SDS PAGE gels (BioRad) were used for electrophoretic separation of immuno purified samples ...
-
bioRxiv - Immunology 2021Quote: ... 4-15% gradient gels (Bio-Rad 4561086) and transferred to PVDF membranes (ThermoFisher ...
-
bioRxiv - Cell Biology 2019Quote: ... run on 4-20 % polyacrylamide gels (BioRad) according to manufacturer’s instructions and analyzed by adding InstantBlue (Expedeon).
-
bioRxiv - Microbiology 2019Quote: ... loaded on 4-20% polyacrylamide gels (BioRad), and transferred to Immobilon-P Transfer Membranes (Millipore Corp) ...
-
bioRxiv - Immunology 2021Quote: ... Ly6B.2 (clone 7/4, Bio-Rad), CD133 (clone 13A4 ...
-
bioRxiv - Genetics 2021Quote: ... 4% (wt/vol) acrylamide (Bio-Rad, USA), 0.05% (wt/vol ...
-
bioRxiv - Neuroscience 2021Quote: ... 4% w/v acrylamide (Bio-Rad 1610140), 0.05% w/v bis-acrylamide (Bio-Rad 1610142) ...
-
bioRxiv - Plant Biology 2020Quote: ... in 4-mm electroporation cuvettes (Bio-Rad) with the following setting ...
-
bioRxiv - Cell Biology 2021Quote: ... 4-20% gradient (Bio-Rad, Hercules, California), and in the case of immunoblot analysis ...
-
bioRxiv - Cell Biology 2021Quote: ... separated in 4-20% SDS–PAGE (BioRad) and electroblotted to nitrocellulose membrane ...
-
bioRxiv - Molecular Biology 2022Quote: ... or 4-20% TGX (Bio-Rad, 4561096) for visualization of auto- ubiquitylation or substrate ubiquitylation ...
-
bioRxiv - Bioengineering 2022Quote: ... Polyacrylamide gels (Bio-Rad, 4-16 wt%). IFNγ ELISA (430104 ...
-
bioRxiv - Cancer Biology 2022Quote: ... 4 mm gap (Bio-Rad, Hercules, CA) containing 20 µg pCas-Ov-grn-1 ...
-
bioRxiv - Molecular Biology 2022Quote: ... separated by 4-15% SDS-PAGE (BioRad), transferred and treated with a polyclonal rabbit anti-TDP-43 antibody (ProteinTech ...
-
bioRxiv - Neuroscience 2023Quote: ... or 4-20% Tris-glycine gel (BioRad) and blotted on a PVDF membrane (BioRad) ...
-
bioRxiv - Microbiology 2021Quote: ... a 96-well plate was loaded into the QX200 Auto DG to generate droplets (Bio-Rad, IL USA) in each well ...
-
bioRxiv - Microbiology 2020Quote: ... vascular endothelial growth factor (VEGF) and IL-18 were measured on a Bio-Plex 200 instrument (Bio-Rad) using the Non-Human Primate Cytokine MILLIPLEX map 23-plex kit (Millipore ...
-
Bat influenza vectored NS1-truncated live vaccine protects pigs against heterologous virus challengebioRxiv - Microbiology 2020Quote: ... The membrane was incubated with a primary mouse anti-pig IL-18 antibody (diluted 1:500, Bio-Rad) or anti-β-actin antibody (diluted 1:500 ...
-
bioRxiv - Microbiology 2022Quote: ... from 22 people were quantified using a Bio-Plex Pro™ Human Inflammation 24-Plex Panel or a Bio-Plex Pro™ Human Th17 Cytokine Panel 15-Plex Panel (Bio-Rad, Hercules, CA, USA). Cytokines were omitted from further analyses if their concentration was close to the lower limit of detection in most samples ...
-
bioRxiv - Microbiology 2022Quote: ... and 4 µg of protein was separated by SDS-PAGE using pre-cast TGX 4-15% gradient gels (BioRad). Protein was transferred to a 0.45 µm nitrocellulose membrane ...
-
bioRxiv - Neuroscience 2022Quote: ... Protein samples were run on 4-20% precast polyacrylamide gel (4-20% Mini-PROTEAN TGX Precast Protein Gels, BioRad) to separate them and transferred onto PVDF membranes using semi-dry transfer ...
-
bioRxiv - Cell Biology 2023Quote: ... SDS–PAGE was carried out using 4-15% or 4-20% precast polyacrylamide gels (Bio-Rad, 4561086 or 4561093) and run at a constant voltage of 80 V for 5 min followed by 120 V for 1 h ...
-
bioRxiv - Cancer Biology 2023Quote: ... The eluent was isolated by centrifugation at 100 g for 4 min at 4°C (Bio-Rad 732-6204), buffer exchanged (Amicon Ultra 10 kDa MWCO UFC501024 ...
-
bioRxiv - Genomics 2024Quote: ... samples were embedded in a thin polyacrylamide film by inverting them onto a GelSlick-coated microscope slide with a droplet of 4% acrylamide solution (4% v/v 20:1 acrylamide:bis-acrylamide [BioRad, 1610144] with 0.15% v/v TEMED [Sigma ...
-
bioRxiv - Cell Biology 2024Quote: ... with DTT and resolved on 4-15% 4-20% or 12% Mini-PROTEAN® TGX™ Precast Gels (Biorad) run in Tris/Glycine/SDS running buffer (Biorad) ...