Labshake search
Citations for Bio-Rad :
101 - 150 of 5061 citations for Human Complexin 2 CPLX2 CLIA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2022Quote: ... or anti-Human IgG Kappa (STAR 127, Bio-Rad, USA) control antibody
-
bioRxiv - Microbiology 2022Quote: ... and HRP-conjugated goat anti-human IgG (BioRad #172-1050) were used as secondary antibodies for ELISA and western blot assays.
-
bioRxiv - Immunology 2019Quote: ... or RasGRP1 (PrimePCR SYBR Green Assay RasGRP1 human, Bio-Rad, amplicon context sequence GGTTCCTTGGTTCCCGGGCATAGGAAAGCTCATAGATTTCATCCTCAGTGTAGTAAAGAT CCAGGGATAACGTCAGCAAGTGTACCAAGTCCTTGTTAGCCTCCAAGG (exon 10) ...
-
bioRxiv - Cancer Biology 2021Quote: ... Bio-Plex Pro Human Cytokine ICAM-1 (BioRad, USA; 171B6009M) and Bio-Plex Pro Human Cytokine VCAM-1 (BioRad ...
-
bioRxiv - Immunology 2023Quote: ... goat anti-human– horseradish peroxidase (HRP) secondary antibody (Bio-Rad) at a 1:3,000 dilution was applied for 1 h at 4°C ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Mouse monoclonal anti-Human Vinculin (V284) antibody (Bio-Rad, MCA465GA), 1:1,000 ...
-
bioRxiv - Plant Biology 2021Quote: ... plants were irradiated with UV-B lamps using fixtures mounted 30 cm above the plants (2 W m−2 UV-B and 0.6 W m−2 UV-A, Bio-Rad ChemiDoc™XRS UV-B lamps ...
-
bioRxiv - Genetics 2021Quote: ... qPCR was carried out using BioMaster HS-qPCR SYBR Blue (2×) reagent kit (Biolabmix; https://biolabmix.ru/en/) and CFX96™ Real-Time PCR Detection System (Bio-Rad). We used the following thermal cycling conditions ...
-
bioRxiv - Systems Biology 2022Quote: ... Drugs were then added to the plates and protein was harvested after 2 hours using the Bio-Plex Pro Cell Signaling Reagent Kit (BioRad 171304006M) according to the manufacturer’s instructions ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... We then performed quantitative PCR (qPCR) using 2 ng of cDNA for each reaction using the iTaq Universal SYBR Green Supermix kit (Bio-Rad) on a Bio-Rad CFX384 thermocycler ...
-
bioRxiv - Plant Biology 2021Quote: ... and 2 μg of the RNA was employed to synthesize cDNA using the iScript cDNA Synthesis Kit (Bio-Rad, Munich, Germany). Quantitative RT- qPCR analysis was performed on a Bio-Rad iQ5 real-time PCR instrument with the iQ SYBR Green Supermix (Bio-Rad ...
-
bioRxiv - Developmental Biology 2019Quote: ... total RNA from Astyanax embryos of various stages (2-24 hpf) was reverse-transcribed using the iScript cDNA synthesis kit (Bio-Rad) and amplified using the following primers:
-
bioRxiv - Genomics 2021Quote: The nuclei solution were adjusted to 43°C for 3 min and melted 2% agarose from CHEF Genomic DNA Plug Kits (Bio-Rad) was added to reach a 0.82% agarose plug concentration ...
-
bioRxiv - Cancer Biology 2022Quote: ... and 2 μg of RNA was used to synthesize cDNA with Bio-RAD iScript cDNA Synthesis Kit (170-8891, Bio-Rad). qRT-PCR was performed using Taqman universal PCR mix and predesigned gene expression assays with best coverage from Applied Biosystems ...
-
bioRxiv - Immunology 2022Quote: Luminex beads used for the serological and purified antibody binding assays were prepared by covalent coupling of SARS-CoV-2 proteins with MagPlex beads using the manufacturer’s protocol with a Bio-Plex Amine Coupling Kit (Bio-Rad, France). Each of the SARS-CoV-2 Spike proteins expressed with different mutations were coupled with different colored MagPlex beads so that tests could be performed with a single protein bead per well or in a multiplexed Luminex binding assay ...
-
bioRxiv - Microbiology 2022Quote: Cell pellets from 2 mL overnight cultures were used to create gel plugs using the CHEF Bacterial Genomic DNA Plug Kit (Bio-rad). DNA was digested with I-SceI ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... We then performed quantitative polymerase chain reaction (qPCR) using 2 ng of complementary DNA for each reaction using the iTaq Universal SYBR Green Supermix kit (Bio-Rad) on a Bio-Rad CFX384 thermocycler ...
-
bioRxiv - Cell Biology 2023Quote: ... 2 μg of RNA template was converted to cDNA using iScript™ cDNA Synthesis Kit (1708891, Bio-Rad, Hercules, CA, USA), according to the manufactures’ instructions ...
-
bioRxiv - Microbiology 2023Quote: ... The reaction mixtures contained 100 ng RNA template per sample diluted 2-fold with qPCR solution (iTaq Universal SYBR Green One-Step Kit, Bio-Rad) containing the primers D2S and D2C ...
-
bioRxiv - Cancer Biology 2023Quote: ... Reverse transcription (RT) was performed from 2 to 5 µg of RNA with iScript Adv cDNA synthesis kit (Bio-Rad #1725038). The cDNA was diluted 5 times and 1 μL of this was used for each reaction in real-time PCR ...
-
bioRxiv - Cell Biology 2020Quote: ... 2% SDS (Bio-Rad), 10% glycerol (Sigma) ...
-
bioRxiv - Genomics 2021Quote: ... 0.128mM 2-Mercaptoethanol (BioRad), and 1X Leukemia Inhibitory Factor (purified and gifted by Barbara Panning Lab at UCSF).
-
bioRxiv - Biophysics 2021Quote: ... 2% bis-AA (BioRad) as described elsewhere 72,73 ...
-
bioRxiv - Cancer Biology 2020Quote: ... 2% bis-AA (BioRad) as described elsewhere (Fischer et al. ...
-
bioRxiv - Genomics 2022Quote: ... 2% SDS (Bio-Rad) and 2 mg/mL proteinase K (New England Biolabs) ...
-
bioRxiv - Developmental Biology 2019Quote: ... Bis (2%, Bio-Rad), the sonicated nanorod-water solution (sonicated in in bath sonicator for one hour ...
-
CXCR4-binding PET tracers link monocyte recruitment and endothelial injury in murine atherosclerosisbioRxiv - Pathology 2020Quote: ... MOMA-2 (Bio-Rad), CD45.2 (104 ...
-
bioRxiv - Biochemistry 2020Quote: ... Biobeads SM-2 (BioRad) were presoaked in methanol ...
-
bioRxiv - Cancer Biology 2022Quote: ... and 2- Mercaptoethanol (BioRad) and ran through a 4-20% Mini-ProTEAN TGX gel (BioRad) ...
-
bioRxiv - Neuroscience 2022Quote: ... with 2-mercaptaethanol (BioRad) and boiled at 95 °C for 5 minutes ...
-
bioRxiv - Cancer Biology 2023Quote: ... using Tetrad 2 (BioRad) following the manufactures protocols ...
-
bioRxiv - Cell Biology 2023Quote: ... and 2-Mercaptoethanol (BioRad) at 95°C for 5 minutes.
-
bioRxiv - Microbiology 2022Quote: ... from 22 people were quantified using a Bio-Plex Pro™ Human Inflammation 24-Plex Panel or a Bio-Plex Pro™ Human Th17 Cytokine Panel 15-Plex Panel (Bio-Rad, Hercules, CA, USA). Cytokines were omitted from further analyses if their concentration was close to the lower limit of detection in most samples ...
-
bioRxiv - Microbiology 2019Quote: ... and FLAG-cMCF-HA recovered as described above were prepped using the Bio-Rad ReadyPrep 2-D Cleanup Kit (Bio-Rad 1632130). The sample was then loaded onto 11 cm pH 3-10 immobilized pH gradient (IPG ...
-
bioRxiv - Microbiology 2022Quote: ... the fluorescence of the EvaGreen dye incorporated into the PCR product was measured at the end of each cycle using SoFast EvaGreen Supermix 2× kit (Bio-Rad, France). A standard curve using gDNA of purified viruses was performed in parallel of each experiment ...
-
bioRxiv - Microbiology 2023Quote: ... for real-time PCR analysis of SARS-CoV-2 E genes using the iTaq Universal Probes One-Step RT-PCR Kit (Bio-Rad, USA) and the QuantStudio™ 5 Real-Time PCR System (Applied Biosystems™ ...
-
bioRxiv - Cancer Biology 2024Quote: ... Protein pellet was resuspended in UTC buffer (8 M urea, 2 M thiourea, 4% CHAPS) and quantified using RC DC™ Protein Assay Kit (Bio-Rad). Sample with 80 µg proteins resuspended in rehydration buffer (8 M urea ...
-
bioRxiv - Microbiology 2024Quote: ... the fluorescence of the EvaGreen dye incorporated into the PCR product was measured at the end of each cycle using SoFast EvaGreen Supermix 2× kit (Bio-Rad, France). A standard curve using the gDNA of purified viruses was performed in parallel with each experiment ...
-
bioRxiv - Biochemistry 2021Quote: ... Human primers were designed by using Beacon Designer software (Bio-Rad). Quantitative PCR was performed on a CFX96 real-time PCR thermocycler (Bio-Rad ...
-
bioRxiv - Immunology 2019Quote: The following antibodies were used: anti-human CD53 (MEM-53, Biorad), anti-human CD53-488 (MEM-53 ...
-
bioRxiv - Cancer Biology 2021Quote: ... and Bio-Plex Pro Human Cytokine VCAM-1 (BioRad, USA; 171B6022M) were used ...
-
bioRxiv - Immunology 2020Quote: Human CTL were transfected using a GenePulser Xcell electroporation system (BioRad). 1x106 CTL (5days after restimulation therefore in expansion phase ...
-
bioRxiv - Pathology 2023Quote: ... or mouse monoclonal antibodies against human C3d (Bio-Rad Laboratories, CA) and C4d (Santa Cruz ...
-
bioRxiv - Neuroscience 2024Quote: ... Primers/probes to detect human RPP30 (BioRad Custom Assay, Hercules, CA) were used as an endogenous reference in human samples ...
-
bioRxiv - Immunology 2021Quote: ... then blocked with 2% blocking buffer (PBS + 2% non-fat dry milk (Bio-Rad) + 2% goat serum + 0.05% Tween-20 ...
-
bioRxiv - Immunology 2022Quote: ... then blocked with 2% blocking buffer (PBS + 2% non-fat dry milk (Bio-Rad) + 2% goat serum + 0.05% Tween-20 ...
-
bioRxiv - Immunology 2019Quote: ... and 2-Mercapoethanol (BIO-RAD) was added to every protein sample with 5 minutes boiling prior to running on gels for western blots ...
-
bioRxiv - Biophysics 2019Quote: ... Bio-Beads SM-2 (Biorad) were added to a 50 mg ml-1 concentration and incubated at 4° C overnight to remove detergent.
-
bioRxiv - Cell Biology 2019Quote: ... and 2-Mercaptoethanol (BioRad #1610710) and boiled at 95°C for 5 minutes ...
-
bioRxiv - Genomics 2020Quote: ... + 2 μl SilentFect (Bio-Rad) was incubated at RT for 5 min before mixing with 2 μl siRNA (20 μM stock ...