Labshake search
Citations for Bio-Rad :
101 - 150 of 3775 citations for 8 DECYLOXYPYRENE 1 3 6 TRISULFONIC ACID TRISODIUM SALT since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2020Quote: ... Gelatin (9000-70-8) was purchased from Bio-Rad. The reagents for RT-qPCR include the RNeasy Mini Kit (Qiagen) ...
-
bioRxiv - Immunology 2023Quote: ... The membranes were blocked with 8% skim milk (BioRad) and incubated with mouse anti-trout IgM mAb or rabbit anti-trout IgT pAb as described in (10) ...
-
bioRxiv - Synthetic Biology 2021Quote: Supernatant or periplasmic fractions were diluted 3:1 in 4× Laemmli sample buffer (Bio-Rad) and were boiled at 100 °C for 10 min ...
-
bioRxiv - Cancer Biology 2020Quote: ... Protein samples were diluted (3:1) with a 4x Laemmli sample buffer (Biorad, Cat# 1610747) and heated at 98 °C for 5 min ...
-
bioRxiv - Bioengineering 2023Quote: ... for 1–3 hours at 100 V and then transferred to PVDF membrane (Bio-Rad) at 40 V for 2–8 hours ...
-
bioRxiv - Molecular Biology 2020Quote: ... Excessive salt and residual NTPs were removed by using P30 column (Bio-Rad, Cat# 732–6250), followed by treatment with DNase I (Promega Cat# M6101 ...
-
bioRxiv - Microbiology 2023Quote: ... 6’,-diamidino-2-phenylindole (DAPI; BIO-RAD) at room temperature for 30 minutes ...
-
bioRxiv - Biochemistry 2021Quote: ... Western blot was performed using 8 or 10% mini gels followed by wet transfer (1 h, 100 V) to Western grade nitrocellulose (Bio-Rad). Blots were incubated in Intercept blocking buffer (LI-COR ...
-
bioRxiv - Immunology 2022Quote: ... Equal volumes of diluted (1:8) cDNA were loaded for qPCR analysis along with the SsoAdvanced Universal SYBR Green Supermix (BioRad #1725272) and 0.5 μM forward and reverse primers for target genes (listed below) ...
-
bioRxiv - Plant Biology 2021Quote: ... thaliana (5’-CAGGCGGTGGAAACTACCAAG-3’ and 5’-TACAGCACTGCACGGGTCGAT-3’) and R129_E (5’-CGAGCTAATCTCCAAAAGCCATC-3’ and 5’-TGACCCTACCGTGGTTAGCTG-3’) with iQ SYBR Green Supermix (BIO-RAD), as described previously (Garrido-Oter et al. ...
-
bioRxiv - Immunology 2023Quote: ... 5’ GACGTGGGCTCCTTACACTGA 3’)(41) and 18s (Fwd: 5’ CTTAGAGGGACAAGTGGCG 3’, Rev: 5’ ACGCTGAGCCAGTCAGTGTA 3’)(42) using the SsoFast assay system (BioRad) was used to quantify transcripts in a BioRad CFX94 machine.
-
bioRxiv - Biochemistry 2023Quote: ... pre-run for 1 hour at 4 ° C and run for 1 hour at 120 volts on Mini-Protean 3 gels (Bio-Rad).
-
bioRxiv - Bioengineering 2023Quote: ... This step was repeated for 3 times and the samples were concentration-matched at OD500nm = 10 and mixed 1:1 with 2x Laemmli buffer (Bio-Rad), containing SDS and 2-mercaptoethanol ...
-
bioRxiv - Biophysics 2019Quote: ... Gel precursor solutions were prepared with 6% v/v acrylamide and 0.2% v/v bisacrylamide (30% acrylamide/bisacrylamide stock 29:1, BioRad), 2 mM LAP photoinitiator (Sigma ...
-
bioRxiv - Genetics 2023Quote: ... followed by purification and size selection on 1% agarose gel with .6 µg/mL ethidium bromide (BioRad Cat#1610433), selecting for the 7,961 bp band ...
-
bioRxiv - Microbiology 2021Quote: ... pulse times 6-36 s at 6 V/cm on a Bio-Rad CHEF MAPPER apparatus (Bio-Rad Laboratories). Restriction profiles were analyzed using the BioNumerics version 7.10 finger-printing software.
-
bioRxiv - Cell Biology 2021Quote: ... 2-3 μg of total protein were loaded onto 10% SDS-polyacrylamide (29:1 Bio-Rad) gels with 10 μM phostag reagent (FUJIFILM Wako Chemicals ...
-
bioRxiv - Molecular Biology 2020Quote: ... Normalised samples (1 – 3 µg) were electrophoresed on 12% Mini-Protean TGX Stain-Free gels (BioRad) or 4-20% Criterion TGX Stain-Free Precast gels (BioRad ...
-
bioRxiv - Microbiology 2024Quote: ... 10% glycerol) then boiled with 1/3 volume of 4x Laemmli sample buffer (Bio-Rad, 1610747) for 10 mins ...
-
bioRxiv - Cancer Biology 2021Quote: ... 8% of 2% w/v bis-acrylamide (Bio-Rad, #1610142), 0.5% of 10% ammonium persulfate (APS ...
-
bioRxiv - Cancer Biology 2021Quote: ... Samples were resolved using 8% or 12% SDS-PAGE (BioRad) or 4-12% gradient NuPAGE Protein Gel (Thermo Fisher) ...
-
bioRxiv - Microbiology 2021Quote: ... at 8°C in a MyCyclerTM thermal cycler (Bio-Rad). At the indicated intervals ...
-
bioRxiv - Neuroscience 2021Quote: ... 8) anti-CD68 (#MCA1957GA, Bio-Rad Laboratories, Hercules, CA, USA) and anti-Iba-1 (#019-19741 ...
-
bioRxiv - Biophysics 2020Quote: ... 8 mL of isopropanol-washed Affigel 10 resin (BioRad; # 1536099) was mixed gently in an Erlenmeyer flask for 20 h at room temperature with 48 mL of DMSO containing 24 mg of xanthine amine congener (XAC ...
-
bioRxiv - Biochemistry 2022Quote: ... Samples were resolved by SDS-PAGE (8-16%, Bio-Rad) and visualized by Coomassie staining ...
-
bioRxiv - Microbiology 2022Quote: Cell lysates were resolved on gradient gels (4-8%; BioRad) and blotted onto nitrocellulose membranes ...
-
bioRxiv - Neuroscience 2022Quote: ... 1:4 & 1:8) and loaded in triplicates onto a nitrocellulose membrane assembled in a 96-well dot-blot apparatus (Biorad, Cat#1703938). The membrane was then stained with Ponceau (Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2023Quote: ... The blot was washed 3 times with TBST for 5 minutes and was incubated with 10 mL of 3% BSA/TBST (w/v) with 1 µL anti-mouse-HRP secondary antibody (1:10,000; Bio-Rad, 170-6516) for 30 minutes at room temperature ...
-
bioRxiv - Cell Biology 2020Quote: ... gossypii proteins) or TBS (S. cerevisiae proteins) supplemented with 1 mM DTT using pre-equilibrated BioSpin-6 spin columns (BioRad) or ...
-
bioRxiv - Cell Biology 2021Quote: ... Membranes were blocked with 6% milk (BioRad 1706404) in Tris buffered saline (TBS ...
-
bioRxiv - Biophysics 2020Quote: ... or Micro Bio-Spin 6 columns (Bio-Rad)) according to the manufacturers’ protocols ...
-
bioRxiv - Developmental Biology 2020Quote: ... The extracts were separated on 6% polyacrylamide (Biorad) gel and transferred onto nitrocellulose membranes in Tris/glycine transfer buffer ...
-
bioRxiv - Biochemistry 2021Quote: ... 6 mL gravity flow columns were from Biorad, Germany.
-
bioRxiv - Genetics 2023Quote: ... China) using TBE (65 mM Tris-HCl, 27 mM boric acid, 1 mM EDTA, pH 9; Bio-Rad, Hercules, CA, USA) as the buffer ...
-
bioRxiv - Microbiology 2020Quote: Surface Plasmon Resonance (SPR) binding experiments were carried out on a ProteOn XPR36 6×6 channels protein interaction array system (Bio-Rad). Proteins BRD4-BD1 an BRD4-BD2 were diluted to a final concentration of 50μg/ml in HEPES buffer 25 mM pH 7.0 and immobilized to a GLM chip using amine coupling ...
-
bioRxiv - Plant Biology 2019Quote: ... 5 µg of plasmid DNA were bound to 3 mg gold micro-carriers (1 µm, Bio-Rad) by adding 50 µL of 2.5 M CaCl2 and 20 µL of 0.1 M spermidine ...
-
bioRxiv - Plant Biology 2021Quote: ... membranes were washed 3 times 5 min with washing solution and incubated 1 h with anti-rabbit IgG HRP-conjugated secondary antibodies (Bio-Rad, 1:3000) at room temperature ...
-
bioRxiv - Cell Biology 2023Quote: ... for 3 hours followed by 20 μM Nigericin for 3 hours (ICT9146, Bio-Rad).
-
bioRxiv - Immunology 2021Quote: ... Proteins were separated in 8% SDS-PAGE mini-gel (Bio-Rad), blotted to PVDF membrane (Millipore ...
-
bioRxiv - Microbiology 2021Quote: ... DNA molecular weight standard (BioRad, CHEF DNA size 8-48-kb) was used as reference.
-
bioRxiv - Evolutionary Biology 2020Quote: ... then to 97°C for 8 min in a thermocycler (BioRad). We centrifuged the samples and froze the supernatant for further use.
-
bioRxiv - Biochemistry 2022Quote: ... before analysis on 8% SDS-PAGE or gradient (4-15%, BioRad) gels and western blotting using anti-FMRP (Cell signaling #LS-C82231 ...
-
bioRxiv - Molecular Biology 2020Quote: ... Samples were analyzed in quadruplicate on 8-16% TGX gels (BioRad) that had previously been equilibrated in 0.5X TBE for 30 minutes at 150V ...
-
bioRxiv - Cell Biology 2021Quote: ... 8 μl of 10% (w/w) tetramethylethylenediamine (TEMED, BioRad 161-0800) accelerator and 4 μl of 10% (w/w ...
-
bioRxiv - Cell Biology 2022Quote: ... Cell were labelled with rabbit anti-IL-8 antibody (Biorad Biosciences), mouse anti-IL-1β antibody (Invitrogen) ...
-
bioRxiv - Cell Biology 2022Quote: ... Cells were stained with rabbit anti-IL-8 antibody (Biorad Biosciences) and mouse anti-IL-1β antibody (Invitrogen ...
-
bioRxiv - Molecular Biology 2020Quote: ... The deamination reaction was then carried out by incubating in a thermal cycler for four cycles of 5 minutes at 70°C followed by 1 hour at 60°C and then desalted with Micro Bio-spin 6 chromatography columns (Bio-Rad). RNA was desulphonated by adding an equal volume of 1 M Tris (pH 9.0 ...
-
bioRxiv - Microbiology 2019Quote: ... The libraries were quantified and checked for amplifiable adapters using the Library Quantification DNA standards 1-6 (Kappa Biosystems, Wilmington, USA) with the SsoFast EvaGreen qPCR supermix (Bio-Rad) using 10 μL EvaGreen master mix ...
-
bioRxiv - Cell Biology 2021Quote: ... as previously described 58 and a custom Bio-Rad 6-plex based on the Human Inflammation Panel 1 (BioRad, Cat# 171AL001M). For both assays ...
-
bioRxiv - Biochemistry 2022Quote: ... and purified by vertical gel electrophoresis on a 6% (60:1 Acrylamide/Bisacrylamide) native gel column using a 491 Prep Cell (Bio-rad) run at 10W and 4°C ...