Labshake search
Citations for Bio-Rad :
101 - 150 of 3301 citations for 7 nitro 3 phenyl 1 naphthol since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2022Quote: ... and 0.2% ampholytes pH 3-10 (BioRad) and added to 7 cm ReadyStrip IPG Strips with a linear pH range of 3-10 (BioRad ...
-
bioRxiv - Molecular Biology 2021Quote: ... and transferred to nitrocellulose membrane (Whatman Protran BA85, cat. No. 10401196) (25 V, 1 A, 3 0min using Trans Blot Turbo transfer system (Bio-Rad). Membrane was blocked with 5% milk and probed with anti-mAID (1:5,000 ...
-
bioRxiv - Zoology 2019Quote: ... 0.5 ml of the heptane phase were mixed with ethanol in a 1:3 ratio (v/v) and the absorbance at 233 nm was measured on a SmartSpec Plus spectrophotometer (Bio-Rad) with extraction blanks used as references ...
-
bioRxiv - Cell Biology 2021Quote: ... the membranes were washed 3 times for 5 min and incubated with the secondary antibodies (1:10000, IgG-HRP, Bio-Rad) for 45 min at RT ...
-
bioRxiv - Plant Biology 2022Quote: ... RNA electrophoresis was performed at 200 V for 1 h and then RNA was transferred to a nylon membrane using MiniProtean 3 system (BioRad, USA). Transfer conditions were 100 V for 1 h at 4 °C in TBE buffer 1 × ...
-
bioRxiv - Microbiology 2022Quote: ... Beads were washed 3 times in PBS and eluted in 40 μL 2X Laemmli Buffer with 1:20 β-mercapto-ethanol (BioRad) at 95°C for 5 minutes ...
-
bioRxiv - Genomics 2022Quote: ... and incubated at 65°C for 3 mins before running 1% agarose-Etbr gel electrophoresis to detect the cleavage efficiency by ChemiDoc system (Bio-Rad).
-
bioRxiv - Immunology 2022Quote: ... then blocked for 1 to 3 hr at RT with 50 μL/well of blocking buffer (HN: 5% Blotting Grade Blocker, Bio-Rad cat ...
-
bioRxiv - Molecular Biology 2022Quote: ... using 10 mM CAPS buffer (3-[cyclohexylamino]-1-propanesulfonic acid [pH 11]) in a Mini Trans-Blot Electrophoretic Transfer Cell tank (Bio-Rad) according to protocol provided by the manufacturer ...
-
Comprehensive mutational analysis of the checkpoint signaling function of Rpa1/Ssb1 in fission yeastbioRxiv - Genetics 2023Quote: ... the membrane was blotted with the Chk1-pS345 antibody at the 1:3000 dilution for 3 h to detect the phosphorylated Chk1-Ser345 in ChemiDoc (Bio-Rad). The membrane was stripped ...
-
bioRxiv - Molecular Biology 2024Quote: ... then incubated with ProSignal Pico Spray chemiluminescence substrate (Prometheus) for 1-3 minutes at room temperature and imaged using a ChemiDoc Imaging System (Bio-Rad). Contrast was occasionally adjusted to improve visualization of bands ...
-
bioRxiv - Microbiology 2021Quote: ... The reaction products were resolved on 15% denaturing PAGE gel with 7 M Urea (Bio-Rad #3450091), and was exposed to a phosphor screen (Amersham ...
-
bioRxiv - Microbiology 2021Quote: ... and final extension at 72°C for 7 min using a C1000 Touch Thermal Cycle (BIO-RAD). PCR results were run on 1% agarose gels and imaged using an iBright CL1500 Imaging system (ThermoFisher Scientific).
-
bioRxiv - Molecular Biology 2023Quote: ... for 7 min with a constant 2.5 A using a Trans-Blot Turbo transfer system (Bio-Rad).
-
bioRxiv - Cancer Biology 2023Quote: ... for 7 minutes and separated with 4-20% Mini-PROTEAN TGX protein Gel (Bio-Rad, Cat # 5671094), transferred to nitrocellulose membranes according to standard protocol ...
-
bioRxiv - Molecular Biology 2023Quote: The WB samples were loaded on a 4-20% or 7% Midi CriterionTM TGXTM Precast gel (BioRad) and ran at 180V for 45min in 1x running buffer (190mM glycine ...
-
bioRxiv - Microbiology 2023Quote: ... 7 µg of each cell extract was loaded on a 12% stain-free SDS-PAGE gel (BioRad) and separated by gel electrophoresis at 175 V for 45 min ...
-
bioRxiv - Neuroscience 2024Quote: ... and heated at 95°C for 7 min prior to separation by 10% SDS-PAGE (BioRad Laboratories). Following electrophoresis ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... gene expression was normalized with the housekeeping gene Act5c (primers: 5’ –gcgcccttactctttcacca-3’ and 5’ - atgtcacggacgatttcacg-3’. We performed the RT-qPCR analysis with SYBR Green (BioRad) or qPCRBIO SyGreen Blue Mix LO-ROX (PCR BIOSYSTEMS ...
-
bioRxiv - Plant Biology 2021Quote: ... The IEF was performed on the 7cm length gel strips with immobilized pH gradients 3-10 and 3-6 (BioRad). After IEF ...
-
bioRxiv - Systems Biology 2020Quote: ... Slides were washed with PBS (3 times, 3 min) and developed using the BCIP-NBT detection system (Bio-Rad Laboratories) for 12 min followed by washing with PBS (3 times ...
-
bioRxiv - Biochemistry 2019Quote: ... supplemented with 0.02% pI 3-10 ampholites (BioRad). Isoelectric focusing was performed in a Protean™ IEF cell (Bio-Rad ...
-
bioRxiv - Cell Biology 2021Quote: ... After 3 washes with 0.05% tween20 (Bio-Rad) in TBS buffer (Bio-Rad) ...
-
bioRxiv - Microbiology 2022Quote: ... Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was detected by using a 1:1,000 anti-GAPDH hFAB™ Rhodamine antibody (Bio-Rad, Hercules, CA) in 5% milk TBST (Tris buffer saline plus Tween-20) ...
-
bioRxiv - Microbiology 2022Quote: ... 300 nM concentration of each primer targeting the viral DNA substrate (5’- AGCGTGGGCGGGAAAATCTC-3’) and the indicated target DNA (table 1) and 1X iTaq Universal SYBR Green Supermix (Bio-Rad Laboratories). The qPCR cycling conditions for quantifying INS activity included an initial incubation at 95°C for 3 minutes ...
-
bioRxiv - Bioengineering 2022Quote: ... The PVDF membrane was then washed 3 × 10 min with TBST and incubated with horseradish peroxidase (HRP)-conjugated goat anti-mouse (diluted 1:20,000; Bio-Rad, Hercules, CA) secondary antibody for one hour at room temperature followed by 6 × 10 min washes with TBST and detection using the Radiance Plus chemiluminescence substrate (Azure Biosystems ...
-
bioRxiv - Neuroscience 2023Quote: ... Sections were blocked using 5% BSA in PBS and incubated overnight at 4 °C with 1 or an appropriate combination of up to 3 of the following antibodies: rat anti-CD8 (1:500, catalog no. MCA609G; Bio-Rad Laboratories), rat anti-CD4 (1:1,000 ...
-
bioRxiv - Neuroscience 2023Quote: ... Samples were prepared for gel electrophoresis by adding a volume containing 20 ug protein to 3 uL 1 M DTT and 7.5 μL 4X Laemmli sample buffer (BioRad Cat. No. 1610747) and topping up to 30 μL with deionized water ...
-
bioRxiv - Biochemistry 2024Quote: ... were annealed at a ratio of 3:1 molar ratio Incubated at 93°C for 3 minutes and slowly cooling down in C1000 Touch™ Thermal Cycler (Bio-Rad). The pre-annealed RNA-TS (32 µM ...
-
bioRxiv - Genomics 2021Quote: ... The proteins were separated in the first dimension on 4-7 and 5-8 IPG strips (Bio-Rad). The strips were then loaded onto 8-20% gradient PAGE for separation on the second dimension ...
-
bioRxiv - Cell Biology 2020Quote: ... and the slices were transfected at 4 – 7 days in vitro using a Helios gene gun (Bio-Rad). Slices were examined at 1 – 2 weeks post-transfection.
-
bioRxiv - Cancer Biology 2020Quote: ... The plate was run on an ABI ViiA 7 instrument and analyzed with CFX manager software (Bio-Rad).
-
bioRxiv - Biochemistry 2021Quote: ... immobilized pH gradient (IPG) strips of 18 cm having a pH range 4-7 (Ready Strips, Bio-Rad) were used and were rehydrated overnight at RT ...
-
bioRxiv - Neuroscience 2023Quote: ... and transferred onto nitrocellulose at 25 V for 7 min using the Trans-blot Turbo system (Bio-Rad). Blotting efficiency was visualized by red Ponceau staining on membranes ...
-
bioRxiv - Biochemistry 2023Quote: ... and transferred at 1.3 A/25 V for 7 min using the Trans-Blot Turbo system (Bio-Rad). Afterwards ...
-
bioRxiv - Genetics 2022Quote: ... reverse 5’ - CACGTGGGACCGCTCGTCTCC) and MUC3B-specific primers (forward 5’ CGGGGGCCAGTGGGATGGCCTCAAG-3’; reverse 5’-CACGCGGGACCGCTCGTCTCT-3’) using SsoFast EvaGreen Supermix (#1725200, Bio-Rad) on a CFX96 Real-Time PCR Detection System (Bio-Rad ...
-
bioRxiv - Biochemistry 2021Quote: ... 5 μg of lysate was heat denatured for 3 minutes at 95°C for 3 minutes and resolved on a pre-cast 4-15 % SDS-PAGE gels (Bio-Rad) at 200V for 45 minutes in 1X running buffer (25mM Tris pH 8.3 ...
-
bioRxiv - Immunology 2022Quote: ... and mouse hypoxanthine-guanine phosphoribosyltransferase gene (Hprt) (forward, 5’-GGACTTGAATCAAGTTTGTG-3’; reverse, 5’-CAGATGTTTCCAAACTCAAC-3’) in a CFX96 Real-Time PCR Detection System (Bio-Rad). The qRT-PCR results were analyzed using the ΔCt method (relative expression ...
-
bioRxiv - Microbiology 2019Quote: ... of total 16S rRNA gene copies was carried out in triplicate 10µL reactions with 200nM 891F(5’-TGGAGCATGTGGTTTAATTCGA-3’)/1003R(5’-TGCGGGACTTAACCCAACA-3’) primers using a BioRad CFX384 thermocycler with iTaqTM Universal Probes Supermix (BioRad 1725132) and probe 1002P ([Cy5]CACGAGCTGACGACARCCATGCA[BHQ3] ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... 5’-TAA TCA GAC AAG GAA CTG ATT A-3’ // Reverse: 5’-CGA AGG TGT GAC TTC CAT G-3’) and CFX96 Touch Real-Time PCR Detection System (Bio-Rad).
-
bioRxiv - Microbiology 2023Quote: ... US28 (sense, 5’-CCAGAATCGTTGCGGTGTCTCAGT-3’; antisense, 5’-CGTGTCCACAAACAGCGTCAGGT-3’) and GAPDH were detected with CFX Connect Real Time System (Bio-Rad) using iTaq Universal SYBR Green Supermix (Bio-Rad) ...
-
bioRxiv - Microbiology 2023Quote: ... and primer set previously described [25] CtPl+ 5’-TAGTAACTGCCACTTCATCA-3’ and CtP2 5’-TTCCCCTTGTAATTCGTTGC-3’) and using a CFX96TM real-time thermocycler (Bio-Rad)) ...
-
bioRxiv - Cancer Biology 2020Quote: ... Membranes were rinsed 3×10 minutes in TBST 0.1% then incubated with appropriate secondary antibody coupled to the horseradish peroxidase (Biorad, 1706515, 1706516; 1/5000) for 1 hour at room temperature under agitation ...
-
bioRxiv - Biochemistry 2020Quote: ... Total RNA (1 µg) from each sample sets (n=3) was taken for cDNA preparation using iScript™ cDNA Synthesis Kit (Bio-Rad, USA). Real-Time qPCR was performed using PowerUp SYBR Green Master Mix (Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2022Quote: ... then blocked for 1 to 3 hr at RT with 50 μL/well of blocking buffer: 2% Blotting Grade Blocker (Bio-Rad cat. # 1706404) and 2% heat-inactivated goat serum (Gibco ...
-
bioRxiv - Microbiology 2023Quote: ... 1 µL primer 556R (5’ CTTTACGCCCARTRAWTCCG 3’) at 10 µM and 10 µL SYBER® Green Master Mix (Bio-Rad, Veenendaal, The Netherlands). The DNA extraction estimated an average rRNA yield corresponding to 5×10^8 bacterial cells/mL.
-
bioRxiv - Cancer Biology 2022Quote: ... 5’ - GAT GGA GAA AGC TCT GAG CAT C -3’ Reverse: 5’ - TTG CTC CAC AGA TGG AGT TG -3’ RHAMM PrimePCR primers were obtained from BioRad (Cat#: 10025636)
-
bioRxiv - Microbiology 2024Quote: ... The hypervariable region V3–V4 of the bacterial 16S rRNA gene was amplified using the primers 338F (5’-ACTCCTACGGGAGGCAGCAG-3’)/ 806R (5’-GGACTACHVGGGTWTCTAAT-3’) by using a T100 Thermal Cycler PCR thermocycler (BIO-RAD, USA). The PCR reaction mixture (20 µL ...
-
bioRxiv - Developmental Biology 2021Quote: ... was performed in 7 min at 1.3 A and 25 V using a Trans-Blot TurboTM transfer system (BioRad). Recognition and revelation of the his-tagged protein was performed as described for the Dot Blot ...
-
bioRxiv - Neuroscience 2019Quote: ... “any kD” (to quantify GDNF protein) or 7% (to quantify CBP) precast polyacrylamide gel (Bio-rad, Hercules, Cal, USA) and transferred to a polyvinylidene difluoride membrane (PVDF ...