Labshake search
Citations for Bio-Rad :
101 - 150 of 1642 citations for 7 BROMOQUINOLINE 2 3 DICARBOXYLIC ACID since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: ... for 7 minutes and separated with 4-20% Mini-PROTEAN TGX protein Gel (Bio-Rad, Cat # 5671094), transferred to nitrocellulose membranes according to standard protocol ...
-
bioRxiv - Molecular Biology 2023Quote: The WB samples were loaded on a 4-20% or 7% Midi CriterionTM TGXTM Precast gel (BioRad) and ran at 180V for 45min in 1x running buffer (190mM glycine ...
-
bioRxiv - Microbiology 2023Quote: ... 7 µg of each cell extract was loaded on a 12% stain-free SDS-PAGE gel (BioRad) and separated by gel electrophoresis at 175 V for 45 min ...
-
bioRxiv - Neuroscience 2024Quote: ... and heated at 95°C for 7 min prior to separation by 10% SDS-PAGE (BioRad Laboratories). Following electrophoresis ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... gene expression was normalized with the housekeeping gene Act5c (primers: 5’ –gcgcccttactctttcacca-3’ and 5’ - atgtcacggacgatttcacg-3’. We performed the RT-qPCR analysis with SYBR Green (BioRad) or qPCRBIO SyGreen Blue Mix LO-ROX (PCR BIOSYSTEMS ...
-
bioRxiv - Plant Biology 2021Quote: ... The IEF was performed on the 7cm length gel strips with immobilized pH gradients 3-10 and 3-6 (BioRad). After IEF ...
-
bioRxiv - Systems Biology 2020Quote: ... Slides were washed with PBS (3 times, 3 min) and developed using the BCIP-NBT detection system (Bio-Rad Laboratories) for 12 min followed by washing with PBS (3 times ...
-
bioRxiv - Molecular Biology 2022Quote: ... (2) post-AP beads were washed twice in 500μl 2% SDS wash buffer (2% v/v SDS (BioRad, #1610418), 150mM NaCl ...
-
bioRxiv - Biochemistry 2019Quote: ... supplemented with 0.02% pI 3-10 ampholites (BioRad). Isoelectric focusing was performed in a Protean™ IEF cell (Bio-Rad ...
-
bioRxiv - Cell Biology 2021Quote: ... After 3 washes with 0.05% tween20 (Bio-Rad) in TBS buffer (Bio-Rad) ...
-
bioRxiv - Microbiology 2021Quote: ... An Aminex HPX-87H Organic Acid Analysis Column (300 × 7.8 mm, Bio-Rad) was equilibrated with 5 mM H2SO4 (Titrisol ...
-
bioRxiv - Microbiology 2019Quote: ... An Aminex HPX-87H organic acid analysis column (300 × 7.8 mm, Bio-Rad) was equilibrated with 5 mM H2SO4 (Titrisol ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: Total protein lysate concentrations were quantified using a bicinchoninic acid (BCA) assay (BioRAD) according to the manufacturer’s protocol.
-
bioRxiv - Microbiology 2021Quote: ... An organic acid column (Aminex HPX-87H 300 × 7.8 mm, Bio-Rad, USA) was employed for the analysis ...
-
bioRxiv - Microbiology 2019Quote: ... Separation was achieved over an Aminex HPX-87H organic acid column (BioRad, USA) under isocratic conditions (0.05 mM H2SO4 ...
-
bioRxiv - Cancer Biology 2020Quote: ... protein content was determined with a bicinchoninic acid reagent (Bio-Rad, Hercules, CA). Equal loading was verified in a twin run of electrophoresed individual strips of protein stained with Ponceau S (Sigma ...
-
bioRxiv - Molecular Biology 2022Quote: ... in 1x Tris/acetic acid/EDTA (TAE) buffer (Bio-Rad, catalog no. 1610743) at 2.8 V/cm for 6 h 45 min with constant buffer recirculation ...
-
bioRxiv - Biochemistry 2023Quote: ... adjusted using acetic acid) using size-exclusion spin columns (MicroBioSpin-6; Bio-Rad); the final concentration of AT was 10 μM ...
-
bioRxiv - Genomics 2021Quote: ... The proteins were separated in the first dimension on 4-7 and 5-8 IPG strips (Bio-Rad). The strips were then loaded onto 8-20% gradient PAGE for separation on the second dimension ...
-
bioRxiv - Cell Biology 2020Quote: ... and the slices were transfected at 4 – 7 days in vitro using a Helios gene gun (Bio-Rad). Slices were examined at 1 – 2 weeks post-transfection.
-
bioRxiv - Cancer Biology 2020Quote: ... The plate was run on an ABI ViiA 7 instrument and analyzed with CFX manager software (Bio-Rad).
-
bioRxiv - Biochemistry 2021Quote: ... immobilized pH gradient (IPG) strips of 18 cm having a pH range 4-7 (Ready Strips, Bio-Rad) were used and were rehydrated overnight at RT ...
-
bioRxiv - Neuroscience 2023Quote: ... and transferred onto nitrocellulose at 25 V for 7 min using the Trans-blot Turbo system (Bio-Rad). Blotting efficiency was visualized by red Ponceau staining on membranes ...
-
bioRxiv - Biochemistry 2023Quote: ... and transferred at 1.3 A/25 V for 7 min using the Trans-Blot Turbo system (Bio-Rad). Afterwards ...
-
bioRxiv - Plant Biology 2021Quote: ... plants were irradiated with UV-B lamps using fixtures mounted 30 cm above the plants (2 W m−2 UV-B and 0.6 W m−2 UV-A, Bio-Rad ChemiDoc™XRS UV-B lamps ...
-
bioRxiv - Genetics 2022Quote: ... reverse 5’ - CACGTGGGACCGCTCGTCTCC) and MUC3B-specific primers (forward 5’ CGGGGGCCAGTGGGATGGCCTCAAG-3’; reverse 5’-CACGCGGGACCGCTCGTCTCT-3’) using SsoFast EvaGreen Supermix (#1725200, Bio-Rad) on a CFX96 Real-Time PCR Detection System (Bio-Rad ...
-
bioRxiv - Biochemistry 2021Quote: ... 5 μg of lysate was heat denatured for 3 minutes at 95°C for 3 minutes and resolved on a pre-cast 4-15 % SDS-PAGE gels (Bio-Rad) at 200V for 45 minutes in 1X running buffer (25mM Tris pH 8.3 ...
-
bioRxiv - Immunology 2022Quote: ... and mouse hypoxanthine-guanine phosphoribosyltransferase gene (Hprt) (forward, 5’-GGACTTGAATCAAGTTTGTG-3’; reverse, 5’-CAGATGTTTCCAAACTCAAC-3’) in a CFX96 Real-Time PCR Detection System (Bio-Rad). The qRT-PCR results were analyzed using the ΔCt method (relative expression ...
-
bioRxiv - Microbiology 2019Quote: ... of total 16S rRNA gene copies was carried out in triplicate 10µL reactions with 200nM 891F(5’-TGGAGCATGTGGTTTAATTCGA-3’)/1003R(5’-TGCGGGACTTAACCCAACA-3’) primers using a BioRad CFX384 thermocycler with iTaqTM Universal Probes Supermix (BioRad 1725132) and probe 1002P ([Cy5]CACGAGCTGACGACARCCATGCA[BHQ3] ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... 5’-TAA TCA GAC AAG GAA CTG ATT A-3’ // Reverse: 5’-CGA AGG TGT GAC TTC CAT G-3’) and CFX96 Touch Real-Time PCR Detection System (Bio-Rad).
-
bioRxiv - Microbiology 2023Quote: ... US28 (sense, 5’-CCAGAATCGTTGCGGTGTCTCAGT-3’; antisense, 5’-CGTGTCCACAAACAGCGTCAGGT-3’) and GAPDH were detected with CFX Connect Real Time System (Bio-Rad) using iTaq Universal SYBR Green Supermix (Bio-Rad) ...
-
bioRxiv - Microbiology 2023Quote: ... and primer set previously described [25] CtPl+ 5’-TAGTAACTGCCACTTCATCA-3’ and CtP2 5’-TTCCCCTTGTAATTCGTTGC-3’) and using a CFX96TM real-time thermocycler (Bio-Rad)) ...
-
bioRxiv - Cell Biology 2020Quote: ... 2% SDS (Bio-Rad), 10% glycerol (Sigma) ...
-
bioRxiv - Genomics 2021Quote: ... 0.128mM 2-Mercaptoethanol (BioRad), and 1X Leukemia Inhibitory Factor (purified and gifted by Barbara Panning Lab at UCSF).
-
bioRxiv - Biophysics 2021Quote: ... 2% bis-AA (BioRad) as described elsewhere 72,73 ...
-
bioRxiv - Cancer Biology 2020Quote: ... 2% bis-AA (BioRad) as described elsewhere (Fischer et al. ...
-
bioRxiv - Genomics 2022Quote: ... 2% SDS (Bio-Rad) and 2 mg/mL proteinase K (New England Biolabs) ...
-
bioRxiv - Developmental Biology 2019Quote: ... Bis (2%, Bio-Rad), the sonicated nanorod-water solution (sonicated in in bath sonicator for one hour ...
-
CXCR4-binding PET tracers link monocyte recruitment and endothelial injury in murine atherosclerosisbioRxiv - Pathology 2020Quote: ... MOMA-2 (Bio-Rad), CD45.2 (104 ...
-
bioRxiv - Biochemistry 2020Quote: ... Biobeads SM-2 (BioRad) were presoaked in methanol ...
-
bioRxiv - Cancer Biology 2022Quote: ... and 2- Mercaptoethanol (BioRad) and ran through a 4-20% Mini-ProTEAN TGX gel (BioRad) ...
-
bioRxiv - Neuroscience 2022Quote: ... with 2-mercaptaethanol (BioRad) and boiled at 95 °C for 5 minutes ...
-
bioRxiv - Cancer Biology 2023Quote: ... using Tetrad 2 (BioRad) following the manufactures protocols ...
-
bioRxiv - Cell Biology 2023Quote: ... and 2-Mercaptoethanol (BioRad) at 95°C for 5 minutes.
-
bioRxiv - Cancer Biology 2022Quote: ... 5’ - GAT GGA GAA AGC TCT GAG CAT C -3’ Reverse: 5’ - TTG CTC CAC AGA TGG AGT TG -3’ RHAMM PrimePCR primers were obtained from BioRad (Cat#: 10025636)
-
bioRxiv - Microbiology 2024Quote: ... The hypervariable region V3–V4 of the bacterial 16S rRNA gene was amplified using the primers 338F (5’-ACTCCTACGGGAGGCAGCAG-3’)/ 806R (5’-GGACTACHVGGGTWTCTAAT-3’) by using a T100 Thermal Cycler PCR thermocycler (BIO-RAD, USA). The PCR reaction mixture (20 µL ...
-
bioRxiv - Developmental Biology 2021Quote: ... was performed in 7 min at 1.3 A and 25 V using a Trans-Blot TurboTM transfer system (BioRad). Recognition and revelation of the his-tagged protein was performed as described for the Dot Blot ...
-
bioRxiv - Neuroscience 2019Quote: ... “any kD” (to quantify GDNF protein) or 7% (to quantify CBP) precast polyacrylamide gel (Bio-rad, Hercules, Cal, USA) and transferred to a polyvinylidene difluoride membrane (PVDF ...
-
bioRxiv - Microbiology 2020Quote: ... in 0.5×TBE buffer at 4 to 7 °C for 260 h using a CHEF Mapper System (Bio-Rad). Switching time was 1,200 to 4,800 s at 1.5 V/cm with an included angle of 120° ...
-
bioRxiv - Molecular Biology 2022Quote: ... LarA extracted from a 7 cm prep well Mini-PROTEAN® TGX Stain-Free™ gel (#4568091, Bio-Rad) was used for affinity purification of the final antibody.